Transcript asmbl_15161

Sequence
Transcript Sequence for observation asmbl_15161 of TGE0000035:
GGGTCACCAATAGCGACACGGATATGGCCCCGCGGGCGGGGTTTAGGCCCAAAGTGGTGTCGGAGCAGCGCCTATTAGTGTCATCCTCACCGTCACGGCCGGCGCCTCCTCCTGGATTCATTCACTCGCTCTTTTCATTCACGAAGGTAGTGAGGCCTAGTGGAAAGCCATGGAGAGCGCTCTCCCCGCCGCCGGCTTCCTGTACTGGGTCGGCGCGGGCACCGTGGCCTACCTAGCCCTGCGTATTTCGTACTCGCTCTTCACGGCCCTCCGGGTCTGGGGAGTGGGGAATGAGGCGGGGGTCGGCCCGGGGCTCGGAGAATGGGCAGTTGTCACAGGTAGTACTGATGGAATTGGAAAATCATATGCAGAAGAGTTAGCAAAGCATGGAATGAAGGTTGTCCTTATCAGCAGATCAAAGGATAAACTTGACCAGGTTTCCAGTGAAATAAAAGAAAAATTCAAAGTGGAGACAAGAACCATTGCTGTTGACTTTGCATCAGAAGATATTTATGATAAAATTAAAACAGGCTTGGCTGGTCTTGAAATCGGCATCTTAGTGAACAACGTGGGAATGTCGTATGAGTATCCTGAATACTTTTTGGATGTTCCTGACTTGGACAATGTGATCAAGAAAATGATAAATATTAATATTCTTTCTGTTTGTAAGATGACACAATTGGTACTGCCTGGCATGGTGGAAAGATCCAAAGGGGCTATTCTGAACATTTCATCTGGCAGTGGCATGCTCCCTGTCCCACTCTTGACCATCTATTCTGCAACCAAGACTTTTGTAGATTTCTTCTCTCAGTGCCTCCATGAGGAGTATAGGAGCAAGGGCGTCTTTGTGCAGAGTGTCCTGCCATACTTCGTAGCTACAAAACTGGCTAAAATCCGGAAGCCAACTTTGGATAAGCCCTCTCCGGAGACGTTTGTGAAGTCTGCAATTAAAACAGTCGGCCTGCAATCCCGAACCAATGGATACCTGATCCATGCTCTTATGGGCTCGATAATCTCAAACCTGCCTTCTTGGATTTATTTGAAAATAGTCATGAATATGAACAAGTCTACACGGGCTCACTATCTGAAGAAAACCAAGAAGAACTAAGCATTGATAACTGCATTGTAACTTGGCCAGATGCTCCAGCATATGCACGTTCACTGCAAAGCACCCTACTGGTTTTGAAAATCTGACCTTGTCATTTCAATAGTTATTAACATGACTAAATATTATCTTAATTAAGAGGAAAATAGAAGTTGCTTTTAGGGGTTTCTGACATATATTCTGGATACTATCCGAGGTAATTTTGAAGTTTAATATAAATGCTCATATCAAATGAATATAGAACTAATATTGTCGGGAACACCTAATAGAAAGGAATACTATTATAGCAAATCACAGAATGATAGACTCAAGCATAAAACTTGGCAGTTTTATCTGCTTCAAAATGCCATTGATCATTATTCCTGTATTTTCTCTGAAACTGATTATAAAAACCAATGTCCAGCTACTCTTTTGTTTTTGACACTTGAAGAAATGGAGATCGATTTGATTTGTTTATAAGCAGACACACTGCAATTTACAAAGATCTCTTTACGGTTTTATAAAATTATCTTCCAGTTTGTACATTTATATGGAATTGTTCTTTATCAAGGGTAGCTAATGACATGAAAATAATTGTGAAATATGGAATTATTTCTGACACATGAAGCCCACTAAACTATGCTTTCTTATAATGCATATTTCTTCTCAGTTTAAATGTATGTAAATATCGAAGCTATATGGTATGATTTATAAAGATAAATGGGCCAAAGTGTACATTGAGACTGGCAGCCATCTATGGTACCACTGAAACCCTGACCCAGAAAAGTGGCTTGCTTGGACACCCAGCTGCCTTTGTTTCTGCATTAAACCAATATTGATCACACATATGACACAGGCTAGTCCTATAAAAGTAATGACTTCATAGAAATGGCATTATAATTTTTAAGTTGATACTCTACAGGTAGCTATTGATATAATTAGTTTTAATAAAACATGCTGCAACCATGGTATACAACAAAAATACATTTCTTTGGTGATTGAAATTAAGGCCGTATTTACAATGACTTAATATAAGACTGACTTTTATCCTGCTTCATAACTTGTATGGAGAACTCACCAAGAAAGAATTCAATACTGTGAAATATGCAGCAAGAAGATTGGTCTTTACCTAGGCTGTGTTTCCTAAGCTCTGAGTTTTCAGCACCAGTAGATTTGTATTAAAAGAAAAAAAAATGGGGCCTTAGCTTCTGGCTTTTAATTTTGCCAGCTAAGGACATAAAACAAAAATAAACAAACAAAAACAAATAGCCATCTGCTATCAGCATCATTATGTAAAAGAAAATATATTTTAGCCCCTAAAATTAGGAAGAATGTAATCTCAGAATAAAGGTTGTCATTTAAGTTGAATAAATATATAGCTTTATGAAAAACACATTGTTTGCCCTTTTTTCCTCTCATTTCATTGTAGAAATGGTGACACCACAATGACCTGGACAGTATTTTATCTGCTTTCACACATTGGTTGGTTAGTTGGTTGGTTGGTTGGTTGGTGAGTTGGTTTTAGTGTAGTGGTGGTAGATAGAGGAGGGATTCTCTTGCAAGTATACAAAATACTCTCTTTTTCTTTTATCCCAGTTAGAAAATAGTTGTAGGCTAAGCACAGTGGCTTACACCTGTAA