Transcript asmbl_12510

Sequence
Transcript Sequence for observation asmbl_12510 of TGE0003481:
AGGCGCCGAGCGGCCATATTGCGGAGCTGTCTGCGGTGGCGGCGGCGCCTCTCGTCTCCCGCGGGCCAGCGCTCGCACCACCGCTTCTCCCTCCCTGTCGCAGCCGCGCCGCCGCGCAGCGCCCCAGCCACACGCCGGCGGGCAGAAGCCGCCCGCTCTCCGGAAAGTGATAACAGAATTCATTGAAGTGGAGAATTTTTAAAGAAGGTAACAAAAAGAGAAAGAAAATGCCGAAACCAATCAACGTAAGAGTAACTACAATGGATGCTGAGCTGGAATTTGCCATTCAGCCCAATACAACTGGCAAACAACTTTTTGACCAGGTGGTGAAAACAGTTGGTTTGCGTGAGGTCTGGTTTTTTGGGCTGCAGTATGTAGACAGCAAAGGTTATTCTACATGGCTTAAACTAAATAAAAAGGTAACACAGCAGGATGTTAAAAAAGAGAATCCTTTACAGTTCAAGTTTAGAGCTAAATTCTTTCCTGAAGATGTTTCTGAGGAATTAATTCAAGAAATAACCCAGAGACTCTTCTTCTTGCAAGTTAAAGAAGCCATCTTAAATGATGAGATATATTGCCCGCCAGAAACTGCAGTTCTTTTGGCTTCCTATGCTGTCCAAGCCAAGTATGGAGATTACAATAAAGAGATTCATAAGCCAGGCTACCTGGCTAATGATAGACTCCTACCCCAGCGTGTATTGGAACAACACAAACTAACAAAAGAACAGTGGGAAGAAAGAATACAGAACTGGCATGAAGAACATAGAGGAATGTTAAGGGAGGATTCTATGATGGAATACCTGAAGATTGCACAAGATCTAGAAATGTATGGAGTCAACTATTTTGAAATAAAAAATAAAAAAGGAACTGAATTGTGGCTAGGTGTTGATGCTTTGGGTCTGAATATTTATGAGCATGACGACAAGTTAACACCTAAAATTGGTTTTCCCTGGAGTGAAATCAGAAATATTTCATTTAATGACAAAAAATTTGTTATAAAGCCAATCGACAAAAAGGCACCTGATTTTGTGTTTTATGCACCTCGTCTGAGAATCAATAAGCGGATTTTGGCCTTATGTATGGGAAACCATGAACTATACATGCGAAGAAGGAAGCCTGATACTATTGAAGTACAACAGATGAAGGCTCAGGCTAGGGAGGAGAAACATCAGAAGCAGTTGGAAAGGGCACAATTAGAGAATGAAAAGAAGAAAAGAGAAATAGCAGAAAAGGAAAAGGAAAGAATAGAACGTGAAAAGGAAGAGCTAATGGAACGTCTAAAACAAATTGAAGAGCAGACAATTAAAGCTCAGAAAGAACTAGAAGAACAGACTCGAAAAGCTCTAGAACTGGATCAAGAACGAAAACGAGCAAAAGAAGAAGCAGAACGACTTGAAAAGGAGCGTCGAGCTGCTGAAGAGGCAAAGTCTGCCATAGCAAAACAAGCTGCCGACCAGATGAAGAATCAGGAGCAGCTAGCAGCAGAACTTGCTGAATTCACTGCCAAGATTGCACTTCTAGAGGAAGCCAAGAAGAAAAAGGAAGAGGAAGCTACTGAGTGGCAACACAAAGCTTTTGCAGCCCAGGAAGACTTGGAAAAGACCAAAGAAGAGTTAAAAACTGTGATGTCTGCCCCCCCTCCACCTCCACCACCACCAGTCATTCCTCCAACAGAAAACGAACATGATGAACACGATGAGAATAATGCTGAAGCTAGTGCTGAATTATCAAATGAAGGGGTAATGAACCATAGAAGCGAGGAAGAACGTGTAACCGAAACACAGAAAAATGAGCGTGTTAAGAAGCAACTTCAGGCATTAAGTTCAGAATTAGCCCAAGCCAGAGATGAAACCAAGAAAACACAAAATGATGTTCTTCATGCTGAGAATGTTAAAGCAGGCCGTGATAAGTACAAGACTCTGCGACAGATTCGACAAGGCAATACAAAGCAGCGTATCGATGAGTTTGAAGCAATGTGAGAGCTGTTATTTTGCATATATGTTCTTCATAAGCTGAACCACCAACAGAGAAAAGCAGGCCTTTGCAGATATGATGGAATGCATCCCACCTTGCCAAAGCACTTACACCAGTTTGACTGTGCTAGCTAAAAGACAAATTTAAGGGGAGCTCTTCAACATTAAGGCAGTATGATATCATGCTTGGTTTTCTTTTTTCTTTTGGTCCAGGGAATGGAGAATGGTGTTCCATTGCCTCTTTTCACATTTTTTTTCTTTTTCTTTTTTTTT