Transcript asmbl_19260

Sequence
Transcript Sequence for observation asmbl_19260 of TGE0004045:
TAAACTTACAGGTATTGGATATGTCTCAACACCTAGTGTTTAATCCTGACCCTACTAGTTAACTAATTTTGTACTCCCATTCCCTGAAATTTAACTTGTGCCTCTTTCCCCATTGTAAGATAGGTGATGATAATACTATTTATTATAGGGTTACTGTGAAGACAAATAATAAAAACACATATAATGGATTTTAACAAATGCATGAACATATATTTTTTTTTAAAAGGAAAAGCGAGTAACTTCTATGTGCTAAAGATATCACAAACCTCAGGCTCACTTTGAGATTTCAAGAGTCAAGAGAAAATGACTGGTTGGACTTATCATTTGGCTGACCAACTGACTGAAGAGCAAATTGCAGAATTCAAAGAAGCTTTTTCACTATTTGACAAGGATGGTGATGGAACTATAACAACAAAGGAATTGGGAACTGTAATGAGATCTCTTGGGCAGAATCCCACAGAAGCAGAGTTACAGGACATGATTAATGAAGTGGATGCTGATGGTAACGGCACAATTGACTTCCCAGAATTTCTGACAATGATGGCAAGAAAAATGAAAGACACAGACAGTGAAGAAGAAATTAGAGAAGCATTCCGTGTGTTTGACAAGGATGGCAATGGATATATTAGTGCAGCAGAGCTTCGCCATGTGATGACAAACCTTGGAGAGAAGTTAACAGATGAAGAGGTTGATGAGATGATCAGGGAAGCAGATATTGATGGTGATGGTCAAGTAAACTATGAAGAGTTTGTACAAATGATGACAGCAAAGTGAAGACATTGTACAGAATGTGTTAAATTTCTTGTACAAAATTGTTTATTTGCCTTTTGTTTGTAACTTATCTGTAAAAGGTTTCCCCCTACTGTCAAAAAAAATATGCATGTATAGTAATTAGGACTTCATTCCTCCATGTTTTCTTCCCTTAATTGTCATTGTCCTGAAACCTTATTTTAGAAAATTGATCAAGTAACATGTTGCATGTGGCTTACTCTGGATATATCTAAGCCCTTCTGCACATCTAAACTTAGAAGGAGTTGGTCAAATGAGGGAACATCATCTGGGTTATGCCTTTTTTTTAAGTAGTTTTCTTTAGGAACTGTCAGCATGTTGTTGTGAAGTGTGGAGTTGTAACTCTGCGTGGACTATGGACAGTCGACAATATGTACTTAAAAGTTGCACTATTGCAAAACGGGTGTATTATCCAGGTACTCGTACACTATTTTTTTGTACTACTGGTCCTGTACCAGAAACATTTTCTTTTATTGTTACTTGCTTTTTAAACTTTGTTTAGCCACTTAAAGAAAATCTGCTTATGGCACAATTTGCCTCAAATCCATTCCAAGTTGTATATTTGTTTTCCAATAAAAAAAAATTTTACCCAATTTTACCCAACTGTTGCTCTGAATCTGAGTCATTTAATTAACTTGAGGTCAAATAATTTTGAGAATCAGATGTGGAGGTGGTTTCTACTTGGTATAATTTAGATAAGTCTTTTTTTGACTCATCAAGATTTTGTTTAGTTTTTAAATTATACTTTCTTCAGAAGGTTTAAGTGAAAGATAAAAACCTTTTGTTAAGTTGTACCTAGAATAGACTGGCACACGGTAGGTGTTTTAGTGCTTCGTACCTTTTAAATATCTTTTTCAACTATGGCATCTGTTTGTCAGTATTGACTTCAGCCATGCAATTATTTTTCTAAATGTTTGTATTGAGAAAACAACAATCTAAATCTAGGGAGGGAAGCTTATTTTGTTTTTACCTCTATTAATGTTTTTACTCATAGTGCTTTTTAATTCTACCACAAGGCAGAGAATTT