Transcript asmbl_19257

Sequence
Transcript Sequence for observation asmbl_19257 of TGE0004045:
GTGTGGTCACGTCTCGGAGACCCGTAGCTCTTGCAGCATGGAAAAGCGAGTAACTTCTATGTGCTAAAGATATCACAAACCTCAGGCTCACTTTGAGATTTCAAGAGTCAAGAGAAAATGACTGGTTGGACTTATCATTTGGCTGACCAACTGACTGAAGAGCAAATTGCAGAATTCAAAGAAGCTTTTTCACTATTTGACAAGGATGGTGATGGAACTATAACAACAAAGGAATTGGGAACTGTAATGAGATCTCTTGGGCAGAATCCCACAGAAGCAGAGTTACAGGACATGATTAATGAAGTGGATGCTGATGGTAACGGCACAATTGACTTCCCAGAATTTCTGACAATGATGGCAAGAAAAATGAAAGACACAGACAGTGAAGAAGAAATTAGAGAAGCATTCCGTGTGTTTGACAAGGATGGCAATGGATATATTAGTGCAGCAGAGCTTCGCCATGTGATGACAAACCTTGGAGAGAAGTTAACAGATGAAGAGGTTGATGAGATGATCAGGGAAGCAGATATTGATGGTGATGGTCAAGTAAACTATGAAGAGTTTGTACAAATGATGACAGCAAAGTGAAGACATTGTACAGAATGTGTTAAATTTCTTGTACAAAATTGTTTATTTGCCTTTTGTTTGTAACTTATCTGTAAAAGGTTTCCCCCTACTGTCAAAAAAAATATGCATGTATAGTAATTAGGACTTCATTCCTCCATGTTTTCTTCCCTTAATTGTCATTGTCCTGAAACCTTATTTTAGAAAATTGATCAAGTAACATGTTGCATGTGGCTTACTCTGGATATATCTAAGCCCTTCTGCACATCTAAACTTAGAAGGAGTTGGTCAAATGAGGGAACATCATCTGGGTTATGCCTTTTTTTTAAGTAGTTTTCTTTAGGAACTGTCAGCATGTTGTTGTGAAGTGTGGAGTTGTAACTCTGCGTGGACTATGGACAGTCGACAATATGTACTTAAAAGTTGCACTATTGCAAAACGGGTGTATTATCCAGGTACTCGTACACTATTTTTTTGTACTACTGGTCCTGTACCAGAAACATTTTCTTTTATTGTTACTTGCTTTTTAAACTTTGTTTAGCCACTTAAAGAAAATCTGCTTATGGCACAATTTGCCTCAAATCCATTCCAAGTTGTATATTTGTTTTCCAATAAAAAAAAATTTTACCCAATTTTACCCAACTGTTGCTCTGAATCTGAGTCATTTAATTAACTTGAGGTCAAATAATTTTGAGAATCAGATGTGGAGGTGGTTTCTACTTGGTATAATTTAGATAAGTCTTTTTTTGACTCATCAAGATTTTGTTTAGTTTTTAAATTATACTTTCTTCAGAAGGTTTAAGTGAAAGATAAAAACCTTTTGTTAAGTTGTACCTAGAATAGACTGGCACACGGTAGGTGTTTTAGTGCTTCGTACCTTTTAAATATCTTTTTCAACTATGGCATCTGTTTGTCAGTATTGACTTCAGCCATGCAATTATTTTTCTAAATGTTTGTATTGAGAAAACAACAATCTAAATCTAGGGAGGGAAGCTTATTTTGTTTTTACCTCTATTAATGTTTTTACTCATAGTGCTTTTTAATTCTACCACAAGGCAGAGAATTT