Transcript asmbl_25649

Sequence
Transcript Sequence for observation asmbl_25649 of TGE0000874:
GAAAGTGAGCTTCTTGACAAGTGCCAAAATGGCGATGCCTACCACCTAGAACTGGATTGTGCGCTCCATTTCTTTCACCTCAAAGCTGGCCGCCACCGCTGCCACCTGCTCAGAGTGAAATAATGAAGGTGGTCAACCTGAAGCAAGCCATTTTGCAAGCCTGGAAGGAGCGCTGGAGTGACTACCAATGGGCAATCAACATGAAGAAATTCTTTCCTAAAGGAGCCACCTGGGATATTCTCAACCTGGCAGATGCGTTACTAGAGCAGGCCATGATTGGACCATCCCCCAATCCTCTCATCTTGTCCTACCTGAAGTATGCCATTAGTTCCCAGATGGTGTCCTACTCTTCTGTCCTCACAGCCATCAGTAAGTTTGATGACTTTTCTCGGGACCTGTGTGTCCAGGCATTGCTGGACATCATGGACATGTTTTGTGACCGTCTGAGCTGTCACGGCAAAGCAGAGGAATGCATCGGACTGTGCCGAGCCCTTCTTAGCGCCCTCCACTGGCTGCTGCGCTGCACGGCAGCCTCTGCAGAGCGGCTGCGGGAGGGGCTGGAGGCCGGCACTCCAGCCGCTGGGGAGAAGCAGCTTGCCATGTGCCTTCAGCGCCTGGAGAAAACCCTCAGCAGCACCAAGAACCGGGCCCTGCTGCACATCGCCAAACTAGAGGAGGCCTCATTGCACACATCCCAGGGACTTGGGCAGGGTGGCACCCGAGCCAATCAACCAACAGCTTCTTGGACTGCCATCGAGCATTCTCTCTTGAAACTTGGAGAGATCCTGGCCAATCTCAGCAACCCGCAGCTCCGGAGTCAGGCCGAGCAGTGTGGCACCCTCATTAGGAGCATCCCCACGATGCTGTCTGTGCATGCGGAGCAGATGCACAAGACCGGCTTCCCCACTGTCCACGCCGTGATCCTGCTCGAGGGCACCATGAACCTGACAGGCGAGACGCAGTCCCTGGTGGAGCAGCTGACGATGGTGAAGCGCATGCAGCATATCCCCACCCCACTTTTTGTCCTGGAGATCTGGAAAGCTTGCTTCGTGGGGCTCATTGAGTCTCCCGAGGGTACGGAGGAGCTCAAGTGGACAGCTTTCACTTTCCTCAAGATTCCACAGGTTTTGGTGAAGTTGAAGAAGTACTCTCATGGAGACAAGGACTTCACTGAGGATGTCAACTGTGCTTTTGAGTTCCTGCTGAAGCTCACCCCCTTGTTGGACAAAGCTGACCAGCGCTGCAACTGTGACTGTACAAACTTCCTGCTCCAAGAATGTGGCAAGCAGGGGCTTCTGTCTGAGGCCAGCGTCAACAACCTTATGGCTAAGCGCAAAGCGGACCGAGAGCACGCACCCCAGCAGAAATCGGGAGAGAATGCCAACATCCAGCCCAACATCCAGCTGATCCTCCGGGCGGAGCCCACTGTCACAAACATCCTCAAGACGATGGATGCAGACCACTCTAAGTCACCGGAGGGACTGCTGGGAGTCCTGGGCCACATGCTGTCCGGGAAGAGTCTGGACTTGCTGCTGGCTGCCGCCGCCGCCACTGGAAAGCTGAAATCCTTCGCCCGGAAATTCATCAATTTGAATGAATTCACAACCTATGGCAGCGAAGAAAGCACCAAACCGGCCTCCGTCCGGGCCCTGCTGTTTGACATCTCCTTCCTCATGCTGTGCCATGTGGCCCAGACCTATGGTTCAGAGGTGATTCTGTCCGAGTCGCGCACAGGAGCTGAGGTGCCCTTCTTCGAGACCTGGATGCAGACCTGCATGCCTGAGGAGGGCAAGATCCTGAACCCTGACCACCCCTGCTTCCGCCCCGACTCCACCAAAGTGGAGTCCCTGGTGGCCCTGCTCAACAACTCCTCGGAGATGAAGCTAGTGCAGATGAAGTGGCATGAGGCCTGTCTCAGCATCTCAGCCGCCATCTTGGAAATCCTCAATGCCTGGGAGAATGGGGTCCTGGCCTTCGAGTCCATCCAGAAAATCACTGATAACATCAAAGGGAAGGTATGCAGTCTGGCGGTGTGTGCTGTGGCTTGGCTTGTGGCCCACGTCCGGATGCTGGGGCTGGATGAGCGTGAGAAGTCGCTGCAGATGATCCGCCAGCTGGCAGGGCCACTGTTTAGTGAGAACACCCTGCAGTTCTACAATGAGAGGGTGGTGATCATGAACTCGATCCTGGAGCGCATGTGTGCCGACGTGCTGCAGCAGACAGCCACGCAGATCAAGTTTCCCTCCACCGGGGTGGACACAATGCCCTACTGGAACCTGCTGCCCCCCAAGCGGCCCATCAAAGAGGTGCTGACGGACATTTTTGCCAAGGTGCTGGAGAAGGGCTGGGTGGACAGCCGCTCCATCCACATCTTTGACACCCTGCTGCACATGGGCGGCGTCTACTGGTTCTGCAACAACCTGATTAAGGAGCTGCTGAAGGAGACGCGGAAGGAGCACACGCTGCGGGCAGTGGAGCTGCTCTACTCCATCTTCTGCCTGGACATGCAGCAAGTGACCCTGGTCCTGCTGGGCCACATCCTACCTGGCCTGCTCACTGACTCCTCCAAGTGGCACAGCCTCATGGACCCCCCGGGCACTGCTCTTGCCAAGCTGGCCGTGTGGTGTGCCCTCAGTTCCTACTCCTCCCACAAGGGACAGGCGTCCACCCGCCAGAAGAAGAGACACCGCGAAGACATTGAGGATTATATCAGCCTCTTCCCCCTGGACGATGTGCAGCCTTCGAAGTTGATGCGACTGCTGAGCTCTAATGAGGACGATGCCAACATCCTTTCGAGCCCCAACCGATCCATGAGCAGCTCCCTCTCAGCCTCTCAGCTCCACACGGTCAACATGCGGGACCCTCTGAACCGAGTCCTGGCCAACCTGTTCCTGCTCATCTCCTCCATCCTGGGGTCTCGCACCGCTGGCCCCCACACCCAGTTCGTGCAGTGGTTCATGGAGGAGTGTGTGGACTGCCTGGAGCAGGGTGGCCGTGGCAGCGTCCTGCAGTTCATGCCCTTCACCACCGTGTCGGAACTGGTGAAGGTGTCAGCCATGTCCAGCCCCAAGGTGGTTCTGGCCATCACGGACCTCAGCCTGCCCCTGGGCCGCCAGGTGGCTGCTAAAGCCATTGCTGCACTCTGAGGGGCTTGGCATGGCCGCAGTGGGGGCTGGGGACTGGCGCAGCCCCAGGCGCCTCCAAGGGAAGCAGTGAGGAAAGATGAGGCATCGTGCCTCACATCCGCTCCACATGGTGCAAGAGCCTCTAGCGGCTTCCAGTTCCCCGCTCCTGACTCCTGACCTCCAGGATGTCTCCCGGTTTCTTCTTTCAAAATTTCCTCTCCATCTGCTGGCACCTGAGGAGAGTGAGCAGCCTGGACCACAAGCCCAGTGGTCACCCCTGTGTGCGCCCGCCCCAGCCCAGGAGTAGTCTTACCTCTGAGGAACTTTCTAGATGCAAAGTGTGTATGTGTGTGTGTGTGTG