Transcript asmbl_11680

Sequence
Transcript Sequence for observation asmbl_11680 of TGE0057122:
CCGGTCCGGGTGCAAACACGCGGGTCAGCTGATCCGGCCCAACTGCGGCGTCATCCCGGCTATAAGCGCACGGCCTCGGCGACCCTCTCCGACCCGGCCGCCGCCGCCATGCAGCCCTCCAGCCTTCTGCCGCTCGCCCTCTGCCTGCTGGCTGCACCCGCCTCCGCGCTCGTCAGGATCCCGCTGCACAAGTTCACGTCCATCCGCCGGACCATGTCGGAGGTTGGGGGCTCTGTGGAGGACCTGATTGCCAAAGGCCCCGTCTCAAAGTACTCCCAGGCGGTGCCAGCCGTGACCGAGGGGCCCATTCCCGAGGTGCTCAAGAACTACATGGACGCCCAGTACTACGGGGAGATTGGCATCGGGACGCCCCCCCAGTGCTTCACAGTCGTCTTCGACACGGGCTCCTCCAACCTGTGGGTCCCCTCCATCCACTGCAAACTGCTGGACATCGCTTGCTGGATCCACCACAAGTACAACAGCGACAAGTCCAGCACCTACGTGAAGAATGGTACCTCGTTTGACATCCACTATGGCTCGGGCAGCCTCTCCGGGTACCTGAGCCAGGACACTGTGTCGGTGCCCTGCCAGTCAGCGTCGTCAGCCTCTGCCCTGGGCGGTGTCAAAGTGGAGAGGCAGGTCTTTGGGGAGGCCACCAAGCAGCCAGGCATCACCTTCATCGCAGCCAAGTTCGATGGCATCCTGGGCATGGCCTACCCCCGCATCTCCGTCAACAACGTGCTGCCCGTCTTCGACAACCTGATGCAGCAGAAGCTGGTGGACCAGAACATCTTCTCCTTCTACCTGAGCAGGGACCCAGATGCGCAGCCTGGGGGTGAGCTGATGCTGGGTGGCACAGACTCCAAGTATTACAAGGGTTCTCTGTCCTACCTGAATGTCACCCGCAAGGCCTACTGGCAGGTCCACCTGGACCAGGTGGAGGTGGCCAGCGGGCTGACCCTGTGCAAGGAGGGCTGTGAGGCCATTGTGGACACAGGCACTTCCCTCATGGTGGGCCCGGTGGATGAGGTGCGCGAGCTGCAGAAGGCCATCGGGGCCGTGCCGCTGATTCAGGGCGAGTACATGATCCCCTGTGAGAAGGTGTCCACCCTGCCCGCGATCACACTGAAGCTGGGAGGCAAAGGCTACAAGCTGTCCCCAGAGGACTACACGCTCAAGGTGTCGCAGGCCGGGAAGACCCTCTGCCTGAGCGGCTTCATGGGCATGGACATCCCGCCACCCAGCGGGCCACTCTGGATCCTGGGCGACGTCTTCATCGGCCGCTACTACACTGTGTTTGACCGTGACAACAACAGGGTGGGCTTCGCCGAGGCTGCCCGCCTCTAGTTCCCAAGGCGTCCGCGCGCCAGCACAGAAACAGAGGAGAGTCCCAGAGCAGGAGGCCCCTGGCCCAGCGGCCCCTCCCACACACACCCACACACTCGCCCGCCCACTGTCCTGGGCGCCCTGGAAGCCGGCGGCCCAAGCCCGACTTGCTGTTTTGTTCTGTGGTTTTCCCCTCCCTGGGTTCAGAAATGCTGCCTGCCTGTCTGTCTCTCCATCTGTTTGGTGGGGGTAGAGCTGATCCAGAGCACAGATCTGTTTCGTGCATTGGAAGACCCCACCCAAGCTTGGCAGCCGAGCTCGTGTATCCTGGGGCTCCCTTCATCTCCAGGGAGTCCCCTCCCCGGCCCTACCAGCGCCCGCTGGGCTGAGCCCCTACCCCACACCAGGCCGTCCTCCCGGGCCCTCCCTTGGAAACCTGCCCTGCCTGAGGGCCCCTCTGCCCAGCTTGGGCCCAGCTGGGCTCTGCCACCCTACCTGTTCAGTGTCCCGGGCCCGTTGAGGATGAGGCCGCTAGAGGCCTGAGGATGAGCTGGAAGGAGTGAGAGGGGACAAAACCCACCTTGTTGGAGCCTGCAGGGTGGTGCTGGGACTGAGCCAGTCCCAGGGGCATGTATTGGCCTGGAGGTGGGGTTGGGATTGGGGGCTGGTGCCAGCCTTCCTCTGCAGCTGACCTCTGTTGTCCTCCCCTTGGGCGGCTGAGAGCCCCAGCTGACATGGAAATACAGTTGTTGGCCTCCGGCCTCCCCTC