Transcript asmbl_99928

Sequence
Transcript Sequence for observation asmbl_99928 of TGE0056382:
CGGCGAGCGCACCAGCAGCATCCTGGCTCAGCCGCGGCGGTGGCGGGGGCGCAACCAGCGGGCCGAGGCGGCGGCGCCAGCGGCGCCTTAAATAGCATCCAGAGCCGGCGCGGGGCAGGGAGTGGGCTGCAGTGACAGCCGGCGGCGGAGCGGCCGGTCCACGGAGGAGAATTCAGCTTAGAGAACTATCAACACAGGACAATGCAAGCCCATGAGCTGTTCCGGTATTTTCGAATGCCAGAGCTGGTTGACTTCCGACAGTACGTGCGTACTCTTCCGACCAACACGCTTATGGGCTTCGGAGCTTTTGCAGCACTCACCACCTTCTGGTACGCCACGAGACCCAAACCCCTGAAGCCGCCATGCGACCTCTCCATGCAGTCAGTGGAAGTGGCGGGTAGTGGTGGTGCACGAAGATCCGCACTACTTGACAGCGACGAGCCCTTGGTGTATTTCTATGATGATGTCACAACATTATACGAAGGTTTCCAGAGGGGAATACAGGTGTCAAATAATGGCCCTTGTTTAGGCTCTCGGAAACCAGACCAACCCTATGAATGGCTTTCATATAAACAGGTTGCAGAATTGTCGGAGTGCATAGGCTCAGCACTGATCCAGAAGGGCTTCAAGACTGCCCCAGATCAGTTCATTGGCATCTTTGCTCAAAATAGACCTGAGTGGGTGATTATTGAACAAGGATGCTTTGCTTATTCGATGGTGATCGTTCCACTTTATGATACCCTTGGAAATGAAGCCATCACGTACATAGTCAACAAAGCTGAACTCTCTCTGGTTTTTGTTGACAAGCCAGAGAAGGCCAAACTCTTATTAGAGGGTGTAGAAAATAAGTTAATACCAGGCCTTAAAATCATAGTTGTCATGGATGCCTACGGCAGTGAACTGGTGGAACGAGGCCAGAGGTGTGGGGTGGAAGTCACCAGCATGAAGGCGATGGAGGACCTGGGAAGAGCCAACAGACGGAAGCCCAAGCCTCCAGCACCTGAAGATCTTGCAGTAATTTGTTTCACAAGTGGAACTACAGGCAACCCCAAAGGAGCAATGGTCACTCACCGAAACATAGTGAGCGATTGTTCAGCTTTTGTGAAAGCAACAGAGAATACAGTCAATCCTTGCCCAGATGATACTTTGATATCTTTCTTGCCTCTCGCCCATATGTTTGAGAGAGTTGTAGAGTGTGTAATGCTGTGTCATGGAGCTAAAATCGGATTTTTCCAAGGAGATATCAGGCTGCTCATGGATGACCTCAAGGTGCTTCAACCCACTGTCTTCCCCGTGGTTCCAAGACTGCTGAACCGGATGTTTGACCGAATTTTCGGACAAGCAAACACCACGCTGAAGCGATGGCTCTTGGACTTTGCCTCCAAGAGGAAAGAAGCAGAGCTTCGCAGCGGCATCATCAGAAACAACAGCCTGTGGGACCGGCTGATCTTCCACAAAGTACAGTCGAGCCTGGGCGGAAGAGTCCGGCTGATGGTGACAGGAGCCGCCCCGGTGTCTGCCACTGTGCTGACGTTCCTCAGAGCAGCCCTGGGCTGTCAGTTTTATGAAGGATACGGACAGACAGAGTGCACTGCCGGGTGCTGCCTGACCATGCCTGGAGACTGGACCGCAGGCCATGTTGGGGCCCCGATGCCGTGCAATTTGATAAAACTTGTTGATGTGGAAGAAATGAATTACATGGCTGCCGAGGGCGAGGGCGAGGTGTGTGTGAAAGGGCCAAATGTATTTCAGGGCTACTTGAAGGACCCAGCGAAAACAGCAGAAGCTTTGGACAAAGACGGCTGGTTACACACAGGGGACATTGGAAAATGGTTACCAAATGGCACCTTGAAAATTATCGACCGGAAAAAGCACATATTTAAGCTGGCACAAGGAGAATACATAGCCCCTGAAAAGATTGAAAATATCTACATGCGAAGTGAGCCTGTTGCTCAGGTGTTTGTCCACGGAGAAAGCCTGCAGGCATTTCTCATTGCAATTGTGGTACCAGATGTTGAGACATTATGTTCCTGGGCCCAAAAGAGAGGATTTGAAGGGTCGTTTGAGGAACTGTGCAGAAATAAGGATGTCAAAAAAGCTATCCTCGAAGATATGGTGAGACTTGGGAAGGATTCTGGTCTGAAACCATTTGAACAGGTCAAAGGCATCACATTGCACCCTGAATTATTTTCTATCGACAATGGCCTTCTGACTCCAACAATGAAGGCGAAAAGGCCAGAGCTGCGGAACTATTTCAGGTCGCAGATAGATGACCTCTATTCCACTATCAAGGTTTAGTGTGAAGAAGAAAGCTCAGAGGAAATGGCACAGTTCCACAATCTCTTCTCCTGCTGATGGCCTTCATGTTGTTAATTTTGAATACAGCAAGTGTAGGGAAGGAAGCGTTCGTGTTTGACTTGTCCATTCGGGGTTCTTCTCATAGGAATGCTAGAGGAAAGAGAACACTGCCTTACAGTCACCTCATGTTGCAGACCATGTTTATGGTAATACACACTTTCCAAAATGAGCCTTAAAAATTGTAAAGGGGATACTATAAATGTGCTAAGTTATTTGAGACTTCCTCAGTTTAAAAAGTGGGTTTTAAATCTTCTGTCTCCCTGTTTCTCTAATCAAGGGGTTAGGACTTTGCTATCTCTGAGATGTCTGCTACTTGCTGCAAATTCTGCAGCTGTCTGCTGCTCTAAAGAGTACAGTGCACTAGAGGGAAGTGTTCCCTTTAAAAATAAGAACAACTGTCCTGGCTGGAGAATCTCACAAGCGGACCAGAGATCTTTTTAAATCCCTGCTACTGTCCCTTCTCACAGGCATTCACAGAACCCTTCTGATTCGTAAGGGTTACGAAACTCATGTTCTTCTCCAGTCCCCTGTGGTTTCTGTTGGAGCATAAGGTTTCCAGTAAGCGGGAGGGCAGATCCAACTCAGAACCATGCAGATAAGGAGCCTCTGGCAAATGGGTGCTCATCAGAACGCGTGGATTCTCTTTCATGGCAGAATGCTCTTGGACTCGGTTCTCCAGGCCTGATTCCCCGACTCCATCCTTTTTCAGGGGTTATTTAAAAATCTGCCTTAGATTCTATAGTGAAGACAAGCATTTCAAGAAAGAGTTACCTGGATCAGCCATGCTCAGCTGTGACGCCTGAATAACTGTCTACTTTATCTTCACTGAACCACTCACTCTGTGTAAAGGCCAACAGATTTTTAATGTGGTTTTCATATCAAAAGATCATGTTGGGATTAACTTGCCTTTTTCCCCAAAAAATAAACTCTCAGGCAAGCATTTCTTTAAAGCTATTAAGGGAGTATATACTTGAGTACTTATTGAAATGGACAGTAATAAGCAAATGTTCTTATAATGCTACCTGATTTCTATGAAATGTGTTTGACAAGCCAAAATTCTAGGATGTAGAAATCTGGAAAGTTCATTTCCTGGGATTCACTTCTCCAGGGATTTTTTAAAGTTAATTTGGGAAATTAACAGCAGTTCACTTTATTGTGAGTCTTTGCCACATTTGACTGAATTGAGCTGTCATTTGTACATTTAAAGCAGCTGTTTTGGGGTCTGTGAGAGTACATGTATTATATACAAGCACAACAGGGCTTGCACTAAAGAATTGTCATTGTAATAACACTACTTGGTAGCCTAACTTCATATATGTATTCTTAATTGCACAAAAAGTCAATAATTTGTCACCTTGGGGTTTTGAATGTTTGCTTTAAGTGTTGGCTATTTCTATGTTTTATAAACCAAAACAAAATTTCCAAAAACAATGAAGGAAACCAAAATAAATATTTCTGCATTTCAGGTGAGTGAGGCATCTTTTTTAATGTCATGTTTAATATTCGGAACAGCCTGTAATGTGCACAAGCGAAGAGCAAGAATGGCCCTGGGCCTGGAATCCTTCCCAGTTGTC