Transcript asmbl_99927

Sequence
Transcript Sequence for observation asmbl_99927 of TGE0056382:
TGGTTTTGTTAAGTGCTGGTGCCTTCTTTCCAGAACCATGGCCTGAAGAAATCTGCTTATCTGTTCTTTCTTTGCTGTCATGAATTCAGCTTAGAGAACTATCAACACAGGACAATGCAAGCCCATGAGCTGTTCCGGTATTTTCGAATGCCAGAGCTGGTTGACTTCCGACAGTACGTGCGTACTCTTCCGACCAACACGCTTATGGGCTTCGGAGCTTTTGCAGCACTCACCACCTTCTGGTACGCCACGAGACCCAAACCCCTGAAGCCGCCATGCGACCTCTCCATGCAGTCAGTGGAAGTGGCGGGTAGTGGTGGTGCACGAAGATCCGCACTACTTGACAGCGACGAGCCCTTGGTGTATTTCTATGATGATGTCACAACATTATACGAAGGTTTCCAGAGGGGAATACAGGTGTCAAATAATGGCCCTTGTTTAGGCTCTCGGAAACCAGACCAACCCTATGAATGGCTTTCATATAAACAGGTTGCAGAATTGTCGGAGTGCATAGGCTCAGCACTGATCCAGAAGGGCTTCAAGACTGCCCCAGATCAGTTCATTGGCATCTTTGCTCAAAATAGACCTGAGTGGGTGATTATTGAACAAGGATGCTTTGCTTATTCGATGGTGATCGTTCCACTTTATGATACCCTTGGAAATGAAGCCATCACGTACATAGTCAACAAAGCTGAACTCTCTCTGGTTTTTGTTGACAAGCCAGAGAAGGCCAAACTCTTATTAGAGGGTGTAGAAAATAAGTTAATACCAGGCCTTAAAATCATAGTTGTCATGGATGCCTACGGCAGTGAACTGGTGGAACGAGGCCAGAGGTGTGGGGTGGAAGTCACCAGCATGAAGGCGATGGAGGACCTGGGAAGAGCCAACAGACGGAAGCCCAAGCCTCCAGCACCTGAAGATCTTGCAGTAATTTGTTTCACAAGTGGAACTACAGGCAACCCCAAAGGAGCAATGGTCACTCACCGAAACATAGTGAGCGATTGTTCAGCTTTTGTGAAAGCAACAGAGAATACAGTCAATCCTTGCCCAGATGATACTTTGATATCTTTCTTGCCTCTCGCCCATATGTTTGAGAGAGTTGTAGAGTGTGTAATGCTGTGTCATGGAGCTAAAATCGGATTTTTCCAAGGAGATATCAGGCTGCTCATGGATGACCTCAAGGTGCTTCAACCCACTGTCTTCCCCGTGGTTCCAAGACTGCTGAACCGGATGTTTGACCGAATTTTCGGACAAGCAAACACCACGCTGAAGCGATGGCTCTTGGACTTTGCCTCCAAGAGGAAAGAAGCAGAGCTTCGCAGCGGCATCATCAGAAACAACAGCCTGTGGGACCGGCTGATCTTCCACAAAGTACAGTCGAGCCTGGGCGGAAGAGTCCGGCTGATGGTGACAGGAGCCGCCCCGGTGTCTGCCACTGTGCTGACGTTCCTCAGAGCAGCCCTGGGCTGTCAGTTTTATGAAGGATACGGACAGACAGAGTGCACTGCCGGGTGCTGCCTGACCATGCCTGGAGACTGGACCGCAGGCCATGTTGGGGCCCCGATGCCGTGCAATTTGATAAAACTTGTTGATGTGGAAGAAATGAATTACATGGCTGCCGAGGGCGAGGGCGAGGTGTGTGTGAAAGGGCCAAATGTATTTCAGGGCTACTTGAAGGACCCAGCGAAAACAGCAGAAGCTTTGGACAAAGACGGCTGGTTACACACAGGGGACATTGGAAAATGGTTACCAAATGGCACCTTGAAAATTATCGACCGGAAAAAGCACATATTTAAGCTGGCACAAGGAGAATACATAGCCCCTGAAAAGATTGAAAATATCTACATGCGAAGTGAGCCTGTTGCTCAGGTGTTTGTCCACGGAGAAAGCCTGCAGGCATTTCTCATTGCAATTGTGGTACCAGATGTTGAGACATTATGTTCCTGGGCCCAAAAGAGAGGATTTGAAGGGTCGTTTGAGGAACTGTGCAGAAATAAGGATGTCAAAAAAGCTATCCTCGAAGATATGGTGAGACTTGGGAAGGATTCTGGTCTGAAACCATTTGAACAGGTCAAAGGCATCACATTGCACCCTGAATTATTTTCTATCGACAATGGCCTTCTGACTCCAACAATGAAGGCGAAAAGGCCAGAGCTGCGGAACTATTTCAGGTCGCAGATAGATGACCTCTATTCCACTATCAAGGTTTAGTGTGAAGAAGAAAGCTCAGAGGAAATGGCACAGTTCCACAATCTCTTCTCCTGCTGATGGCCTTCATGTTGTTAATTTTGAATACAGCAAGTGTAGGGAAGGAAGCGTTCGTGTTTGACTTGTCCATTCGGGGTTCTTCTCATAGGAATGCTAGAGGAAAGAGAACACTGCCTTACAGTCACCTCATGTTGCAGACCATGTTTATGGTAATACACACTTTCCAAAATGAGCCTTAAAAATTGTAAAGGGGATACTATAAATGTGCTAAGTTATTTGAGACTTCCTCAGTTTAAAAAGTGGGTTTTAAATCTTCTGTCTCCCTGTTTCTCTAATCAAGGGGTTAGGACTTTGCTATCTCTGAGATGTCTGCTACTTGCTGCAAATTCTGCAGCTGTCTGCTGCTCTAAAGAGTACAGTGCACTAGAGGGAAGTGTTCCCTTTAAAAATAAGAACAACTGTCCTGGCTGGAGAATCTCACAAGCGGACCAGAGATCTTTTTAAATCCCTGCTACTGTCCCTTCTCACAGGCATTCACAGAACCCTTCTGATTCGTAAGGGTTACGAAACTCATGTTCTTCTCCAGTCCCCTGTGGTTTCTGTTGGAGCATAAGGTTTCCAGTAAGCGGGAGGGCAGATCCAACTCAGAACCATGCAGATAAGGAGCCTCTGGCAAATGGGTGCTCATCAGAACGCGTGGATTCTCTTTCATGGCAGAATGCTCTTGGACTCGGTTCTCCAGGCCTGATTCCCCGACTCCATCCTTTTTCAGGGGTTATTTAAAAATCTGCCTTAGATTCTATAGTGAAGACAAGCATTTCAAGAAAGAGTTACCTGGATCAGCCATGCTCAGCTGTGACGCCTGAATAACTGTCTACTTTATCTTCACTGAACCACTCACTCTGTGTAAAGGCCAACAGATTTTTAATGTGGTTTTCATATCAAAAGATCATGTTGGGATTAACTTGCCTTTTTCCCCAAAAAATAAACTCTCAGGCAAGCATTTCTTTAAAGCTATTAAGGGAGTATATACTTGAGTACTTATTGAAATGGACAGTAATAAGCAAATGTTCTTATAATGCTACCTGATTTCTATGAAATGTGTTTGACAAGCCAAAATTCTAGGATGTAGAAATCTGGAAAGTTCATTTCCTGGGATTCACTTCTCCAGGGATTTTTTAAAGTTAATTTGGGAAATTAACAGCAGTTCACTTTATTGTGAGTCTTTGCCACATTTGACTGAATTGAGCTGTCATTTGTACATTTAAAGCAGCTGTTTTGGGGTCTGTGAGAGTACATGTATTATATACAAGCACAACAGGGCTTGCACTAAAGAATTGTCATTGTAATAACACTACTTGGTAGCCTAACTTCATATATGTATTCTTAATTGCACAAAAAGTCAATAATTTGTCACCTTGGGGTTTTGAATGTTTGCTTTAAGTGTTGGCTATTTCTATGTTTTATAAACCAAAACAAAATTTCCAAAAACAATGAAGGAAACCAAAATAAATATTTCTGCATTTCAGGTGAGTGAGGCATCTTTTTTAATGTCATGTTTAATATTCGGAACAGCCTGTAATGTGCACAAGCGAAGAGCAAGAATGGCCCTGGGCCTGGAATCCTTCCCAGTTGTC