Transcript asmbl_99925

Sequence
Transcript Sequence for observation asmbl_99925 of TGE0057121:
CGGCGAGCGCACCAGCAGCATCCTGGCTCAGCCGCGGCGGTGGCGGGGGCGCAACCAGCGGGCCGAGGCGGCGGCGCCAGCGGCGCCTTAAATAGCATCCAGAGCCGGCGCGGGGCAGGGAGTGGGCTGCAGTGACAGCCGGCGGCGGAGCGGCCGGTCCACGGAGGAGAATTCAGCTTAGAGAACTATCAACACAGGACAATGCAAGCCCATGAGCTGTTCCGGTATTTTCGAATGCCAGAGCTGGTTGACTTCCGACAGTACGTGCGTACTCTTCCGACCAACACGCTTATGGGCTTCGGAGCTTTTGCAGCACTCACCACCTTCTGGTACGCCACGAGACCCAAACCCCTGAAGCCGCCATGCGACCTCTCCATGCAGTCAGTGGAAGTGGCGGGTAGTGGTGGTGCACGAAGATCCGCACTACTTGACAGCGACGAGCCCTTGGTGTATTTCTATGATGATGTCACAACATTATACGAAGGTTTCCAGAGGGGAATACAGGTGTCAAATAATGGCCCTTGTTTAGGCTCTCGGAAACCAGACCAACCCTATGAATGGCTTTCATATAAACAGGTTGCAGAATTGTCGGAGTGCATAGGCTCAGCACTGATCCAGAAGGGCTTCAAGACTGCCCCAGATCAGTTCATTGGCATCTTTGCTCAAAATAGACCTGAGTGGGTGATTATTGAACAAGGATGCTTTGCTTATTCGATGGTGATCGTTCCACTTTATGATACCCTTGGAAATGAAGCCATCACGTACATAGTCAACAAAGCTGAACTCTCTCTGGTTTTTGTTGACAAGCCAGAGAAGGCCAAACTCTTATTAGAGGGTGTAGAAAATAAGTTAATACCAGGCCTTAAAATCATAGTTGTCATGGATGCCTACGGCAGTGAACTGGTGGAACGAGGCCAGAGGTGTGGGGTGGAAGTCACCAGCATGAAGGCGATGGAGGACCTGGGAAGAGCCAACAGACGGAAGCCCAAGCCTCCAGCACCTGAAGATCTTGCAGTAATTTGTTTCACAAGTGGAACTACAGGCAACCCCAAAGGAGCAATGGTCACTCACCGAAACATAGTGAGCGATTGTTCAGCTTTTGTGAAAGCAACAGAGAATACAGTCAATCCTTGCCCAGATGATACTTTGATATCTTTCTTGCCTCTCGCCCATATGTTTGAGAGAGTTGTAGAGTGTGTAATGCTGTGTCATGGAGCTAAAATCGGATTTTTCCAAGGAGATATCAGGCTGCTCATGGATGACCTCAAGGTGCTTCAACCCACTGTCTTCCCCGTGGTTCCAAGACTGCTGAACCGGATGTTTGACCGAATTTTCGGACAAGCAAACACCACGCTGAAGCGATGGCTCTTGGACTTTGCCTCCAAGAGGAAAGAAGCAGAGCTTCGCAGCGGCATCATCAGAAACAACAGCCTGTGGGACCGGCTGATCTTCCACAAAGTACAGTCGAGCCTGGGCGGAAGAGTCCGGCTGATGGTGACAGGAGCCGCCCCGGTGTCTGCCACTGTGCTGACGTTCCTCAGAGCAGCCCTGGGCTGTCAGTTTTATGAAGGATACGGACAGACAGAGTGCACTGCCGGGTGCTGCCTGACCATGCCTGGAGACTGGACCGCAGGCCATGTTGGGGCCCCGATGCCGTGCAATTTGATAAAACTTGTTGATGTGGAAGAAATGAATTACATGGCTGCCGAGGGCGAGGGCGAGGTGAGTGAAAACCGTCAGTCATTTTCCCTCGCTGCCATTTCCTGTGATCGCTGGCCTTTGCGAATGCTGTGGTATTTCCCAACAGCTCAATAAAGCCATTGAACTTGACTTCATTGGTGATCCTGGAGTCTGCCAGGCTTCTTTCTGAGGGTACATTTATGTTCAGCTCTCGGGGAGTGGGCAGGAGGGACACTGATGCCTGTCTTCCTCTGCCAGGCCTCATAGGGATTTGGGCTGGAGAGCCTGCAAAGAAAGGCCCGGTGGCCTCAGTTCCTGGGACGAAGGTCCTGCCTGTTGATTGCCCTGGGTACCTATTAGTGAGCTGCTGGCTGCTGGATGGGAAGCCTAATTACTTAAAAGTGATTTCATCCCCTGCGGGGCTTTCCAACAGCTTTGAGCCAGAACCTAGGGCAAGCATTTGCCCTACAAATCGGCCAGAGCTGAGGTAATTCAGGAAGGGAAGTAGGGGCACTGGAGATCTCTCGCAGACCCTGGTGGGGCTCTGGTAACTCCCTCTGCATCCTGGAGTTTAGGGCTTCCAGCTAAAGGTTGGGGCAGACACACACGTACACACATGCACACACCAGTTTTCTCTGGAAAAACCCCAGTAAATGCTGTTCACTGATGATCTTCTTTTCTTTAGGTGTGTGTGAAAGGGCCAAATGTATTTCAGGGCTACTTGAAGGACCCAGCGAAAACAGCAGAAGCTTTGGACAAAGACGGCTGGTTACACACAGGGGACATTGGAAAATGGTTACCAAATGGCACCTTGAAAATTATCGACCGGAAAAAGCACATATTTAAGCTGGCACAAGGAGAATACATAGCCCCTGAAAAGATTGAAAATATCTACATGCGAAGTGAGCCTGTTGCTCAGGTGTTTGTCCACGGAGAAAGCCTGCAGGCATTTCTCATTGCAATTGTGGTACCAGATGTTGAGACATTATGTTCCTGGGCCCAAAAGAGAGGATTTGAAGGGTCGTTTGAGGAACTGTGCAGAAATAAGGATGTCAAAAAAGCTATCCTCGAAGATATGGTGAGACTTGGGAAGGATTCTGGTCTGAAACCATTTGAACAGGTCAAAGGCATCACATTGCACCCTGAATTATTTTCTATCGACAATGGCCTTCTGACTCCAACAATGAAGGCGAAAAGGCCAGAGCTGCGGAACTATTTCAGGTCGCAGATAGATGACCTCTATTCCACTATCAAGGTTTAGTGTGAAGAAGAAAGCTCAGAGGAAATGGCACAGTTCCACAATCTCTTCTCCTGCTGATGGCCTTCATGTTGTTAATTTTGAATACAGCAAGTGTAGGGAAGGAAGCGTTCGTGTTTGACTTGTCCATTCGGGGTTCTTCTCATAGGAATGCTAGAGGAAAGAGAACACTGCCTTACAGTCACCTCATGTTGCAGACCATGTTTATGGTAATACACACTTTCCAAAATGAGCCTTAAAAATTGTAAAGGGGATACTATAAATGTGCTAAGTTATTTGAGACTTCCTCAGTTTAAAAAGTGGGTTTTAAATCTTCTGTCTCCCTGTTTCTCTAATCAAGGGGTTAGGACTTTGCTATCTCTGAGATGTCTGCTACTTGCTGCAAATTCTGCAGCTGTCTGCTGCTCTAAAGAGTACAGTGCACTAGAGGGAAGTGTTCCCTTTAAAAATAAGAACAACTGTCCTGGCTGGAGAATCTCACAAGCGGACCAGAGATCTTTTTAAATCCCTGCTACTGTCCCTTCTCACAGGCATTCACAGAACCCTTCTGATTCGTAAGGGTTACGAAACTCATGTTCTTCTCCAGTCCCCTGTGGTTTCTGTTGGAGCATAAGGTTTCCAGTAAGCGGGAGGGCAGATCCAACTCAGAACCATGCAGATAAGGAGCCTCTGGCAAATGGGTGCTCATCAGAACGCGTGGATTCTCTTTCATGGCAGAATGCTCTTGGACTCGGTTCTCCAGGCCTGATTCCCCGACTCCATCCTTTTTCAGGGGTTATTTAAAAATCTGCCTTAGATTCTATAGTGAAGACAAGCATTTCAAGAAAGAGTTACCTGGATCAGCCATGCTCAGCTGTGACGCCTGAATAACTGTCTACTTTATCTTCACTGAACCACTCACTCTGTGTAAAGGCCAACAGATTTTTAATGTGGTTTTCATATCAAAAGATCATGTTGGGATTAACTTGCCTTTTTCCCCAAAAAATAAACTCTCAGGCAAGCATTTCTTTAAAGCTATTAAGGGAGTATATACTTGAGTACTTATTGAAATGGACAGTAATAAGCAAATGTTCTTATAATGCTACCTGATTTCTATGAAATGTGTTTGACAAGCCAAAATTCTAGGATGTAGAAATCTGGAAAGTTCATTTCCTGGGATTCACTTCTCCAGGGATTTTTTAAAGTTAATTTGGGAAATTAACAGCAGTTCACTTTATTGTGAGTCTTTGCCACATTTGACTGAATTGAGCTGTCATTTGTACATTTAAAGCAGCTGTTTTGGGGTCTGTGAGAGTACATGTATTATATACAAGCACAACAGGGCTTGCACTAAAGAATTGTCATTGTAATAACACTACTTGGTAGCCTAACTTCATATATGTATTCTTAATTGCACAAAAAGTCAATAATTTGTCACCTTGGGGTTTTGAATGTTTGCTTTAAGTGTTGGCTATTTCTATGTTTTATAAACCAAAACAAAATTTCCAAAAACAATGAAGGAAACCAAAATAAATATTTCTGCATTTCAGGTGAGTGAGGCATCTTTTTTAATGTCATGTTTAATATTCGGAACAGCCTGTAATGTGCACAAGCGAAGAGCAAGAATGGCCCTGGGCCTGGAATCCTTCCCAGTTGTC