Transcript asmbl_99919

Sequence
Transcript Sequence for observation asmbl_99919 of TGE0056681:
TCCATCTCAAAAAATAATAATAATTGCAGTATTTTTCCTAAGTGATACTGTAAGAGAGATGTAAGGCTGTGAAACTTTTGCGGCAACAGTGCACTAATTTGGATAATGTTTGTTCCCAATAAATTAAGAGCCAAATTGTATGTAACTGGTGCTTTATTTTATTTAACATCAGTTTTTGAAGAATTGGGCATCTCCAGAAGTTATGTAAGAATTTTTAATAGACAAATAGAAATCTGGAGCTAATAAAGGTTATTTTGAAAAAAATGTACAGAATTATTGCTTTAGCTTTTGGCTGACCTCTAATTGGATATATTAGTTCCTGTTCTTAATCGGTGGTCTGTCACTACATCATTTAAAATGTAATTAAGATTGAAAACTTAATGTATGCTGGGCAGAAACTCACTAAGCCCTGAGCACACCCATCTAATTTCCACGTGAATTGAACATGTTCAATGGCGTGTTCAATGGCATGTTCATTCCATATCCTCATTCAAGCTGTTCCATTTGAATAGGAAAAGAATATAAATAGTTCATTTGTTAAAATTAATAGATATTAAAGTGGCCACCAAGACTGCCCTAATGCAGTAAACCGAACCCCATCAGTGGTAGTGACTGGAAGCCTGCCGCTGGGAAATGCTGTCCCCGCGCAATGCTTCTGTCATTCTTAACCTTCAAGTCCATTCAGGAAGGAGTCTTAGAGGGTCTGCTGTGGCCTGTTTTATAATTGGGGGCTCCCAAATCCTATCTCCACTCTACGAGGGGAGATATTTGAGCAGATATTTGAGCCTCTCCAAAATGCCTAGCATTTCAATCGAGCAGAGATTGATTTTTCTTCTTCCCAGATTGCAGATGTCAGTTGTGCAGAATGTGGGGGTGAGGTAGTGCTGTGCTCTGATTTGAGGAACCTACGAAGTATCTGCAGTATCTCGTTATGGTTAAGAACAGGGCTTTATTAAAGGCCCTAATAAGAAGTGGAAGTGGGGACCAGAAATGCATGGTAAAGACTTTGGCTGCTGTTTTTTTAATACATCCTATTTCAAAGACCAGTCCTAATACCGTTTATGTAGTTTTATGTAAGAGAAGAGGTAACTGGAAAATGGCTTCTCAGAACAATGAATAAATATTTTGGTTCTGGTTAATTAAAACTGCCATAGTTTCTTTAATTAGAAAATTATGCTGTTTTCGAGCCAGGTGTGAATGAACCCCACAGTAAAGCCAGCTTTAAGTGACTCGATGTGACCTTATCCTTTACAGTTAGAAAACGTTTCCATTTAAGACTTTTTTTCTCTTCTAATTAAGGACCTGGGAAGAGCCAACAGACGGAAGCCCAAGCCTCCAGCACCTGAAGATCTTGCAGTAATTTGTTTCACAAGTGGAACTACAGGCAACCCCAAAGGAGCAATGGTCACTCACCGAAACATAGTGAGCGATTGTTCAGCTTTTGTGAAAGCAACAGAGAATACAGTCAATCCTTGCCCAGATGATACTTTGATATCTTTCTTGCCTCTCGCCCATATGTTTGAGAGAGTTGTAGAGTGTGTAATGCTGTGTCATGGAGCTAAAATCGGATTTTTCCAAGGAGATATCAGGCTGCTCATGGATGACCTCAAGGTGCTTCAACCCACTGTCTTCCCCGTGGTTCCAAGACTGCTGAACCGGATGTTTGACCGAATTTTCGGACAAGCAAACACCACGCTGAAGCGATGGCTCTTGGACTTTGCCTCCAAGAGGAAAGAAGCAGAGCTTCGCAGCGGCATCATCAGAAACAACAGCCTGTGGGACCGGCTGATCTTCCACAAAGTACAGTCGAGCCTGGGCGGAAGAGTCCGGCTGATGGTGACAGGAGCCGCCCCGGTGTCTGCCACTGTGCTGACGTTCCTCAGAGCAGCCCTGGGCTGTCAGTTTTATGAAGGATACGGACAGACAGAGTGCACTGCCGGGTGCTGCCTGACCATGCCTGGAGACTGGACCGCAGGCCATGTTGGGGCCCCGATGCCGTGCAATTTGATAAAACTTGTTGATGTGGAAGAAATGAATTACATGGCTGCCGAGGGCGAGGGCGAGGTGTGTGTGAAAGGGCCAAATGTATTTCAGGGCTACTTGAAGGACCCAGCGAAAACAGCAGAAGCTTTGGACAAAGACGGCTGGTTACACACAGGGGACATTGGAAAATGGTTACCAAATGGCACCTTGAAAATTATCGACCGGAAAAAGCACATATTTAAGCTGGCACAAGGAGAATACATAGCCCCTGAAAAGATTGAAAATATCTACATGCGAAGTGAGCCTGTTGCTCAGGTGTTTGTCCACGGAGAAAGCCTGCAGGCATTTCTCATTGCAATTGTGGTACCAGATGTTGAGACATTATGTTCCTGGGCCCAAAAGAGAGGATTTGAAGGGTCGTTTGAGGAACTGTGCAGAAATAAGGATGTCAAAAAAGCTATCCTCGAAGATATGGTGAGACTTGGGAAGGATTCTGGTCTGAAACCATTTGAACAGGTCAAAGGCATCACATTGCACCCTGAATTATTTTCTATCGACAATGGCCTTCTGACTCCAACAATGAAGGCGAAAAGGCCAGAGCTGCGGAACTATTTCAGGTCGCAGATAGATGACCTCTATTCCACTATCAAGGTTTAGTGTGAAGAAGAAAGCTCAGAGGAAATGGCACAGTTCCACAATCTCTTCTCCTGCTGATGGCCTTCATGTTGTTAATTTTGAATACAGCAAGTGTAGGGAAGGAAGCGTTCGTGTTTGACTTGTCCATTCGGGGTTCTTCTCATAGGAATGCTAGAGGAAAGAGAACACTGCCTTACAGTCACCTCATGTTGCAGACCATGTTTATGGTAATACACACTTTCCAAAATGAGCCTTAAAAATTGTAAAGGGGATACTATAAATGTGCTAAGTTATTTGAGACTTCCTCAGTTTAAAAAGTGGGTTTTAAATCTTCTGTCTCCCTGTTTCTCTAATCAAGGGGTTAGGACTTTGCTATCTCTGAGATGTCTGCTACTTGCTGCAAATTCTGCAGCTGTCTGCTGCTCTAAAGAGTACAGTGCACTAGAGGGAAGTGTTCCCTTTAAAAATAAGAACAACTGTCCTGGCTGGAGAATCTCACAAGCGGACCAGAGATCTTTTTAAATCCCTGCTACTGTCCCTTCTCACAGGCATTCACAGAACCCTTCTGATTCGTAAGGGTTACGAAACTCATGTTCTTCTCCAGTCCCCTGTGGTTTCTGTTGGAGCATAAGGTTTCCAGTAAGCGGGAGGGCAGATCCAACTCAGAACCATGCAGATAAGGAGCCTCTGGCAAATGGGTGCTCATCAGAACGCGTGGATTCTCTTTCATGGCAGAATGCTCTTGGACTCGGTTCTCCAGGCCTGATTCCCCGACTCCATCCTTTTTCAGGGGTTATTTAAAAATCTGCCTTAGATTCTATAGTGAAGACAAGCATTTCAAGAAAGAGTTACCTGGATCAGCCATGCTCAGCTGTGACGCCTGAATAACTGTCTACTTTATCTTCACTGAACCACTCACTCTGTGTAAAGGCCAACAGATTTTTAATGTGGTTTTCATATCAAAAGATCATGTTGGGATTAACTTGCCTTTTTCCCCAAAAAATAAACTCTCAGGCAAGCATTTCTTTAAAGCTATTAAGGGAGTATATACTTGAGTACTTATTGAAATGGACAGTAATAAGCAAATGTTCTTATAATGCTACCTGATTTCTATGAAATGTGTTTGACAAGCCAAAATTCTAGGATGTAGAAATCTGGAAAGTTCATTTCCTGGGATTCACTTCTCCAGGGATTTTTTAAAGTTAATTTGGGAAATTAACAGCAGTTCACTTTATTGTGAGTCTTTGCCACATTTGACTGAATTGAGCTGTCATTTGTACATTTAAAGCAGCTGTTTTGGGGTCTGTGAGAGTACATGTATTATATACAAGCACAACAGGGCTTGCACTAAAGAATTGTCATTGTAATAACACTACTTGGTAGCCTAACTTCATATATGTATTCTTAATTGCACAAAAAGTCAATAATTTGTCACCTTGGGGTTTTGAATGTTTGCTTTAAGTGTTGGCTATTTCTATGTTTTATAAACCAAAACAAAATTTCCAAAAACAATGAAGGAAACCAAAATAAATATTTCTGCATTTCAGGTGAGTGAGGCATCTTTTTTAATGTCATGTTTAATATTCGGAACAGCCTGTAATGTGCACAAGCGAAGAGCAAGAATGGCCCTGGGCCTGGAATCCTTCCCAGTTGTC