Transcript asmbl_99731

Sequence
Transcript Sequence for observation asmbl_99731 of TGE0056378:
GCTGGCGCGGCCGGCCTGCGGTTGGGGCCCTGGCGGGGGTGGGACGGGCCAAGCCGGGCAGGGCCGGGGTGGGGCCGCTGGCGTTTCCGTTGCTTGGATCAGTCTAGGTGCAGCTGCCGGATCCTTCAGCGTCTGCATCTCGGCGTCGCCCCGCGTACCGTCGCCCGGCTCTCCGCCGCTCTCCCGGGGTTTCGGGGCACTTGGGTCCCACAGTCTGGTCCTGCTTCACCTTCCCCTGACCTGAGTAGTCGCCATGGCACAGGTTCTCAGAGGCACTGTGACTGACTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCTATGAAAGGCTTGGGCACAGATGAGGAGAGCATCCTGACTCTGTTGACATCCCGAAGTAATGCTCAGCGCCAGGAAATCTCTGCAGCTTTTAAGACTCTGTTTGGCAGGGATCTTCTGGATGACCTGAAATCAGAACTAACTGGAAAATTTGAAAAATTAATTGTGGCTCTGATGAAACCCTCTCGGCTTTATGATGCTTATGAACTGAAACATGCCTTGAAGGGAGCTGGAACAAATGAAAAAGTACTGACAGAAATTATTGCTTCAAGGACACCTGAAGAACTGAGAGCCATCAAACAAGTTTATGAAGAAGAATATGGCTCAAGCCTGGAAGATGACGTGGTGGGGGACACTTCAGGGTACTACCAGCGGATGTTGGTGGTTCTCCTTCAGGTATTGCGTGGAGATTAATTACAGTTTGATTAAAAAGCCTGAAGTTGGACTGGGCTGAATCTAGTTAAGTAAGGTCACTTAAAATTCTTTTAATAATTTGTGGTACTTGCTGATTCTTACTGCGATGATTCTGACTGTATGTTGCCTGTGCTTGTTTGTGTTTCAGAATATCTGGTCTAAATTCTTAACAGCTAACTCATACATGTTTTAGATAGTAGTATCTTGTTCCTTTCATAGAATGATAGCGGTATCTTGTTCTTTCATAGAATTTAAAATCAGTAGGGTCATTATTGGTTTTGGACAGTGCTGGGTGATGATAACGTGAAATAGTGCAGGATTGATCTTAATAAAAGCATATTATTCCTAGAGAAAGAGTGTTATTGAATAACCATCAGGTGGAACCATTTTTCCTTTTGAATGAGAATGCTCTATAGTTCAGTAATGTGACATATTACCTCTCATAGGCTAACAGAGACCCTGATGCTGGAATTGATGAAGCTCAAGTTGAACAAGATGCTCAGGCTTTATTTCAGGCTGGAGAACTTAAATGGGGGACAGATGAAGAAAAGTTTATCACCATCTTTGGAACACGAAGTGTGTCTCATTTGAGAAAGGTGTTTGACAAGTACATGACTATATCAGGATTTCAAATTGAGGAAACCATTGACCGCGAGACTTCTGGCAATTTAGAGCAACTACTCCTTGCTGTTG