Transcript asmbl_99600

Sequence
Transcript Sequence for observation asmbl_99600 of TGE0056673:
ACTAGTTTTGAGTGGAGCAGAATTGCCAGTCTGGGAATAATCCAGTGGGTGTGGCTTAAAGACATAGATCACGTGTGGAATTGGAATTGGATGTTACACAAGCAAACAAAATAAATATCTGTGCAATATATCTGCTTTATGCACTCAAGCAGAGAAGAAATCCACAAAGACTCACAGTCTGCTGGTGGGCAGAGAAGACAGAAACGACATGAGCACAGCAGGAAAAGAAAGTTGTCTGACAGAAGTTTGATGAGAGGAATTTGACTCAGAAGACTGAAATATCCTTTAACCTTACTATAAAATATCTTACAAAATACTCATTGATTTCACAGCATTAGAATCATCAAGGTTAAGCAAGACATCAACATGCAAATTCTGATTAAAAGGGGTCCATTATGATACAATTCAGGGAATTTCCACAAAAATCCTATGGAACAGTATCTTCCCCATTTAAAAGTTAATATGGTTTTACAGAAAATCAATGATACAATTTGAATAATAATACAATTTGAATCACTTAGCACTAGGAATACAGATATTTGGTTTTTTCTTCTATAAATTTGTACTTATTTGCTCAATGTGTTTACAGGTGCATGTGGTCATTCAATATAATCAATTGATTTTTTTAATTGTTTAATTACATAAACCTGTGCAACTATGTCCAGTCCTTTTTTTGTGTTAGGAGTGTACCACACTGTAAAATATCTCACTATGATAATTCAATTTAAAGGTTCTGAGGCTTCTCTCTGCATTGTGTGACAAACAGGCTCATATCAATAAGACTGGTTGATGGAGCTAGAGGACGTTATTCTAAGTAAAGTAACTCATGAATGGAACACCAAATATCCAATGTTCTCACTTAAAAGTGGTAGCTAAACTATGAGGACACAAAGGATGAGAATGATATAATGGACTTTGGGGACTGAGGGAAAAGGGCAGTAGGAGGAATAAGACATAAAAGACTACATATTGGGTTCAGTCTACACTGCTTGTGTGAGGGGTGCACCAAAATATCAGAAATCACCACTAAAGAACTTATCCGTGTAACCAAAAACCATCTGCACCCCAAAAACTATTGAAATTAAAAATTAATCAATGAATAAATTTTAAGATAAAAATAATGCATGTAATTTACCCAGCACAGGTCACAATGTGCCTGTCACATCATAAGCACCTCATAATAAGAATCTTCCTACTATTAGTACCTTCTGTCTAAGTATTCTGGTATTTATTTTGGCATTGACCATGTTGAACATCCTACAAAGTTGAAAATTTTGACAAATAAATAATGAAAATGAATTGGCAGAAAAATAAATCTCAATTGAATTTTTAAATTATATTTGCAATTATGTTGGTTCTTTCTAGAAAGGGCTCTGCGAATTATACATGCTTTACCACAACGAAGATGGGTTTTACAGTACACTGCCAAGCACTAGAAATATATGCTGAACTTTATTTTTAAGAACATCTATGGATAAGCTCTGCTAAACAGAAATCCAAGCACACTGTTTCTCCAGTTTTAAAATATACATGCGTGGGTCTGAGTGTATACACACACACACACGTGCACACACACACACCACCAACTCTAATCTCTATAATATTTGGCTCAAATCTAAGCTGAAAGAAGTCTCTACACATAAATTAGATTACAAAACAGGCTGCCAAAGCTAAGTTTCAAATGAGTAGGAAACAAGTAGCACACAGAAGTAGTGGAGAGAGAAAATTAAAAGAGGACAATAAGCAAATAGGGAGAGAAAGAAATGTCATTGTGCGCAGGAAGGTAAATGTATAATTGCTCTTATAGAGTCAGATCCTTTTGGCCTAAGCAGAAAATTGAGCAATAAAGCAGTGTATTTTATGTAGACAGACACTGACTCTGTCAGCAAAATAAAGGTGACTTCTAACTTCATATATCAGCTAATAGTTGTGGGTAGACGAGCATTTTCAGGACGGCATTAGGAAATACCAGGAATAAACACCTTCAGAGAAAAAACAACAACATAAGAATGGCCTAAATAAATATATTCCATTTTTCTCAATGTCTTATTATACTTTGTTTATCTTTCCTTATGTTATTGCTTTTTAAAAGATACTTTTATTCTCTTTATAAACCAGAGTACTTCATTTCCATGGAGCACTTGTTAGGTAATCAAATGCAAAGCAGCTGTGCTATGGGAGGTAAAGAAACCCTTTTCCATTGAGGATGTGGAGGTTGCACCTCCTAAGGCTTATGAAGTTCGCATTAAGATGGTGGCTGTAGGAATCTGTCACACAGATGACCACGTGGTTAGTGGCAACCTGGTGACCCCCCTTCCTGTGATTTTAGGCCATGAGGCAGCCGGCATCGTGGAGAGTGTTGGAGAAGGGGTGACTACAGTCAAACCAGGTGATAAAGTCATCCCGCTCTTTACTCCTCAGTGTGGAAAATGCAGAGTTTGTAAAAACCCGGAGAGCAACTACTGCTTGAAAAATGATCTAGGCAATCCTCGGGGGACCCTGCAGGATGGCACCAGGAGGTTCACCTGCAGGGGGAAGCCCATTCACCACTTCCTTGGCACCAGCACCTTCTCCCAGTACACGGTGGTGGATGAGAATGCAGTGGCCAAAATTGATGCAGCCTCGCCCCTGGAGAAAGTCTGCCTCATTGGCTGTGGATTCTCGACTGGTTATGGGTCTGCAGTTAACGTTGCCAAGGTCACCCCAGGCTCTACCTGTGCTGTGTTTGGCCTGGGAGGGGTCGGCCTATCTGCTGTTATGGGCTGTAAAGCAGCTGGAGCAGCCAGAATCATTGCGGTGGACATCAACAAGGACAAATTTGCAAAGGCCAAAGAGTTGGGTGCCACTGAATGCATCAACCCTCAAGACTACAAGAAACCCATTCAGGAAGTGCTAAAGGAAATGACTGATGGAGGTGTGGATTTTTCGTTTGAAGTCATCGGTCGGCTTGACACCATGATGGCTTCCCTGTTATGTTGTCATGAGGCATGTGGCACAAGCGTCATCGTAGGGGTACCTCCTGCTTCCCAGAACCTCTCAATAAACCCTATGCTGCTACTGACTGGACGCACCTGGAAGGGGGCTGTTTATGGTGGCTTTAAGAGTAAAGAAGGTATCCCAAAACTTGTGGCTGATTTTATGGCTAAGAAGTTTTCACTGGATGCGTTAATAACCCATGTTTTACCTTTTGAAAAAATAAATGAAGGATTTGACCTGCTTCACTCTGGGAAAAGTATCCGTACCGTCCTGACGTTTTGAGGCAATAGAGATGCCTTCCCCTGTAGCAGTCTTCAGCCTCCTCTACCCTACAAGATCTGGAGCAACAGCTAGGAAATATCATTAATTCAGCTCTTCAGAGATGTTATCAATAAATTACACATGGGGGCTTTCCAAAGAAATGGAAATTGATGGGAAATTATTTTTCAGGAAAATTTAAAATTCAAGTGAGAAGTAAATAAAGTGTTGAACATCAGCTGGGGAATTGAAGCCAACAAACCTTCCTTCTTAACCATTCTACTGTGTCACCTTTGCCATTGAGGAAAAATATTCCTGTGACTTCTTGCATTTTTGGTATCTTCATAATCTTTAGTCATCGAATCCCAGTGGAGGGGACCCTTTTACTTGCCCTGAACATACACATGCTGGGCCATTGTGATTGAAGTCTTCTAACTCTGTCTCAGTTTTCACTGTCGACATTTTCCTTTTTCTAATAAAAATGTACCAAATCCCTGGGGTAAAAGCTAGGGTAAGGTAAAGGATAGACTCACATTTACAAGTAGTGAAGGTCCAAGAGTTCTAAATACAGGAAATTTCTTAGGAACTCAAATAAAATGCCCCACATTTTACTACAGTAAATGGCAGTGTTTTTATGACTTTTATACTATTTCTTTATGGTCGATATACAATTGATTTTTTAAAATAATAGCAGATTTCTTGCTTCATATGACAAAGCCTCAATTACTAATTGTAAAAACTGAACTATTCCCAGAATCATGTTCAAAAAATCTGTAATTTTTGCTGATGAAAGTGCTTCATTGACTAAACAGTATTAGTTTGTGGCTATAAATGATTATTTAGATGATGACTGAAAATGTGTATAAAGTAATTAAAAGTAATATGGTGGCTTTAAGTGTAGAGATGGGATGGCAAATGCTGTGAATGCAGAATGTAAAATTGGTAACTAAGAAATGGCACAAACACCTTAAGCAATATATTTTCCTAGTAGATATATATATACACATACATATATACACATATACAAATGTATATTTTTGCAAAATTGTTTTCAATCTAGAACTTTTCTATTAACTACCATGTCTTAAAATCAAGTCTATAATCCTAGCATTAGTTTAATATTTTGAATATGTAAAGACCTGTGTTAATGCTTTGTTAATGCTTTTCCCACTCTCATTTGTTAATGCTTTCCCACTCTCAGGGGAAGGATTTGCATTTTGAGCTTTATCTCTAAATGTGACATGCAAAGATTATTCCTGGTAAAGGAGGTAGCTGTCTCCAAAAATGCTATTGTTGCAATATCTACATTCTATTTCATATTATGAAAGACCTTAGACATAAAGTAAAATAGTTTATCATTTACTGTGTGATCTTCAGTAAGTCTCTCAGGCTCTCTGAGCTTGTTCATCCTTTGTTTTGAAAAAATTACTCAACCAATCCATTACAGCTTAACCAAGATTAAATGGGATGATGTTAATGAAAGAGCTTCGCCAATTAAGAAGGGCCATGTAAATGTGGGTAACCTGATTGTTTTGTCAAAAATGCTAAAGCGGGGTGGGGGGTGGCGCAGTGGCTTATCCCTGTAATCCCAGCACTTTGGGA