Transcript asmbl_99599

Sequence
Transcript Sequence for observation asmbl_99599 of TGE0056673:
ACTAGTTTTGAGTGGAGCAGAATTGCCAGTCTGGGAATAATCCAGTGGGTGTGGCTTAAAGACATAGATCACGTGTGGAATTGGAATTGGATGTTACACAAGCAAACAAAATAAATATCTGTGCAATATATCTGCTTTATGCACTCAAGCAGAGAAGAAATCCACAAAGACTCACAGTCTGCTGGTGGGCAGAGAAGACAGAAACGACATGAGCACAGCAGGAAAAGAAAGTTGTCTGACAGAAGTTTGATGAGAGGAATTTGACTCAGAAGACTGAAATATCCTTTAACCTTACTATAAAATATCTTACAAAATACTCATTGATTTCACAGCATTAGAATCATCAAGGTTAAGCAAGACATCAACATGCAAATTCTGATTAAAAGGGGTCCATTATGATACAATTCAGGGAATTTCCACAAAAATCCTATGGAACAGTATCTTCCCCATTTAAAAGTTAATATGGTTTTACAGAAAATCAATGATACAATTTGAATAATAATACAATTTGAATCACTTAGCACTAGGAATACAGATATTTGGTTTTTTCTTCTATAAATTTGTACTTATTTGCTCAATGTGTTTACAGGTGCATGTGGTCATTCAATATAATCAATTGATTTTTTTAATTGTTTAATTACATAAACCTGTGCAACTATGTCCAGTCCTTTTTTTGTGTTAGGAGTGTACCACACTGTAAAATATCTCACTATGATAATTCAATTTAAAGGTTCTGAGGCTTCTCTCTGCATTGTGTGACAAACAGGCTCATATCAATAAGACTGGTTGATGGAGCTAGAGGACGTTATTCTAAGTAAAGTAACTCATGAATGGAACACCAAATATCCAATGTTCTCACTTAAAAGTGGTAGCTAAACTATGAGGACACAAAGGATGAGAATGATATAATGGACTTTGGGGACTGAGGGAAAAGGGCAGTAGGAGGAATAAGACATAAAAGACTACATATTGGGTTCAGTCTACACTGCTTGTGTGAGGGGTGCACCAAAATATCAGAAATCACCACTAAAGAACTTATCCGTGTAACCAAAAACCATCTGCACCCCAAAAACTATTGAAATTAAAAATTAATCAATGAATAAATTTTAAGATAAAAATAATGCATGTAATTTACCCAGCACAGGTCACAATGTGCCTGTCACATCATAAGCACCTCATAATAAGAATCTTCCTACTATTAGTACCTTCTGTCTAAGTATTCTGGTATTTATTTTGGCATTGACCATGTTGAACATCCTACAAAGTTGAAAATTTTGACAAATAAATAATGAAAATGAATTGGCAGAAAAATAAATCTCAATTGAATTTTTAAATTATATTTGCAATTATGTTGGTTCTTTCTAGAAAGGGCTCTGCGAATTATACATGCTTTACCACAACGAAGATGGGTTTTACAGTACACTGCCAAGCACTAGAAATATATGCTGAACTTTATTTTTAAGAACATCTATGGATAAGCTCTGCTAAACAGAAATCCAAGCACACTGTTTCTCCAGTTTTAAAATATACATGCGTGGGTCTGAGTGTATACACACACACACACGTGCACACACACACACCACCAACTCTAATCTCTATAATATTTGGCTCAAATCTAAGCTGAAAGAAGTCTCTACACATAAATTAGATTACAAAACAGGCTGCCAAAGCTAAGTTTCAAATGAGTAGGAAACAAGTAGCACACAGAAGTAGTGGAGAGAGAAAATTAAAAGAGGACAATAAGCAAATAGGGAGAGAAAGAAATGTCATTGTGCGCAGGAAGGTAAATGTATAATTGCTCTTATAGAGTCAGATCCTTTTGGCCTAAGCAGAAAATTGAGCAATAAAGCAGTGTATTTTATGTAGACAGACACTGACTCTGTCAGCAAAATAAAGGTGACTTCTAACTTCATATATCAGCTAATAGTTGTGGGTAGACGAGCATTTTCAGGACGGCATTAGGAAATACCAGGAATAAACACCTTCAGAGAAAAAACAACAACATAAGAATGGCCTAAATAAATATATTCCATTTTTCTCAATGTCTTATTATACTTTGTTTATCTTTCCTTATGTTATTGCTTTTTAAAAGATACTTTTATTCTCTTTATAAACCAGAGTACTTCATTTCCATGGAGCACTTGTTAGGTACCAGACATGGGACGCAATATTACATGTACAAAGATGAAAAGACACAACTTATGACTTCAAGAGTGGGAAAACACTGTCACCATCTCTCTGTTTGATTTTCTAGGTAATCAAATGCAAAGCAGCTGTGCTATGGGAGGTAAAGAAACCCTTTTCCATTGAGGATGTGGAGGTTGCACCTCCTAAGGCTTATGAAGTTCGCATTAAGATGGTGGCTGTAGGAATCTGTCACACAGATGACCACGTGGTTAGTGGCAACCTGGTGACCCCCCTTCCTGTGATTTTAGGCCATGAGGCAGCCGGCATCGTGGAGAGTGTTGGAGAAGGGGTGACTACAGTCAAACCAGGTGATAAAGTCATCCCGCTCTTTACTCCTCAGTGTGGAAAATGCAGAGTTTGTAAAAACCCGGAGAGCAACTACTGCTTGAAAAATGATCTAGGCAATCCTCGGGGGACCCTGCAGGATGGCACCAGGAGGTTCACCTGCAGGGGGAAGCCCATTCACCACTTCCTTGGCACCAGCACCTTCTCCCAGTACACGGTGGTGGATGAGAATGCAGTGGCCAAAATTGATGCAGCCTCGCCCCTGGAGAAAGTCTGCCTCATTGGCTGTGGATTCTCGACTGGTTATGGGTCTGCAGTTAACGTTGCCAAGGTCACCCCAGGCTCTACCTGTGCTGTGTTTGGCCTGGGAGGGGTCGGCCTATCTGCTGTTATGGGCTGTAAAGCAGCTGGAGCAGCCAGAATCATTGCGGTGGACATCAACAAGGACAAATTTGCAAAGGCCAAAGAGTTGGGTGCCACTGAATGCATCAACCCTCAAGACTACAAGAAACCCATTCAGGAAGTGCTAAAGGAAATGACTGATGGAGGTGTGGATTTTTCGTTTGAAGTCATCGGTCGGCTTGACACCATGATGGCTTCCCTGTTATGTTGTCATGAGGCATGTGGCACAAGCGTCATCGTAGGGGTACCTCCTGCTTCCCAGAACCTCTCAATAAACCCTATGCTGCTACTGACTGGACGCACCTGGAAGGGGGCTGTTTATGGTGGCTTTAAGAGTAAAGAAGGTATCCCAAAACTTGTGGCTGATTTTATGGCTAAGAAGTTTTCACTGGATGCGTTAATAACCCATGTTTTACCTTTTGAAAAAATAAATGAAGGATTTGACCTGCTTCACTCTGGGAAAAGTATCCGTACCGTCCTGACGTTTTGAGGCAATAGAGATGCCTTCCCCTGTAGCAGTCTTCAGCCTCCTCTACCCTACAAGATCTGGAGCAACAGCTAGGAAATATCATTAATTCAGCTCTTCAGAGATGTTATCAATAAATTACACATGGGGGCTTTCCAAAGAAATGGAAATTGATGGGAAATTATTTTTCAGGAAAATTTAAAATTCAAGTGAGAAGTAAATAAAGTGTTGAACATCAGCTGGGGAATTGAAGCCAACAAACCTTCCTTCTTAACCATTCTACTGTGTCACCTTTGCCATTGAGGAAAAATATTCCTGTGACTTCTTGCATTTTTGGTATCTTCATAATCTTTAGTCATCGAATCCCAGTGGAGGGGACCCTTTTACTTGCCCTGAACATACACATGCTGGGCCATTGTGATTGAAGTCTTCTAACTCTGTCTCAGTTTTCACTGTCGACATTTTCCTTTTTCTAATAAAAATGTACCAAATCCCTGGGGTAAAAGCTAGGGTAAGGTAAAGGATAGACTCACATTTACAAGTAGTGAAGGTCCAAGAGTTCTAAATACAGGAAATTTCTTAGGAACTCAAATAAAATGCCCCACATTTTACTACAGTAAATGGCAGTGTTTTTATGACTTTTATACTATTTCTTTATGGTCGATATACAATTGATTTTTTAAAATAATAGCAGATTTCTTGCTTCATATGACAAAGCCTCAATTACTAATTGTAAAAACTGAACTATTCCCAGAATCATGTTCAAAAAATCTGTAATTTTTGCTGATGAAAGTGCTTCATTGACTAAACAGTATTAGTTTGTGGCTATAAATGATTATTTAGATGATGACTGAAAATGTGTATAAAGTAATTAAAAGTAATATGGTGGCTTTAAGTGTAGAGATGGGATGGCAAATGCTGTGAATGCAGAATGTAAAATTGGTAACTAAGAAATGGCACAAACACCTTAAGCAATATATTTTCCTAGTAGATATATATATACACATACATATATACACATATACAAATGTATATTTTTGCAAAATTGTTTTCAATCTAGAACTTTTCTATTAACTACCATGTCTTAAAATCAAGTCTATAATCCTAGCATTAGTTTAATATTTTGAATATGTAAAGACCTGTGTTAATGCTTTGTTAATGCTTTTCCCACTCTCATTTGTTAATGCTTTCCCACTCTCAGGGGAAGGATTTGCATTTTGAGCTTTATCTCTAAATGTGACATGCAAAGATTATTCCTGGTAAAGGAGGTAGCTGTCTCCAAAAATGCTATTGTTGCAATATCTACATTCTATTTCATATTATGAAAGACCTTAGACATAAAGTAAAATAGTTTATCATTTACTGTGTGATCTTCAGTAAGTCTCTCAGGCTCTCTGAGCTTGTTCATCCTTTGTTTTGAAAAAATTACTCAACCAATCCATTACAGCTTAACCAAGATTAAATGGGATGATGTTAATGAAAGAGCTTCGCCAATTAAGAAGGGCCATGTAAATGTGGGTAACCTGATTGTTTTGTCAAAAATGCTAAAGCGGGGTGGGGGGTGGCGCAGTGGCTTATCCCTGTAATCCCAGCACTTTGGGA