Transcript asmbl_98970

Sequence
Transcript Sequence for observation asmbl_98970 of TGE0057119:
GAAAACCGGGCCATGAAGGATGAGGAGAAGATGGAAATTCAGGAGCTGCAGCTCAAAGAGGCCAAGCACATTGCGGAAGAGGCTGACCGCAAATACTGGGAGGTAGCTCGTAAGCTGGTCTTCCTGGAGGGTGAGCTGGAGAGGGCAGAGGAGCGTGTGGAGGTGTCTGAACTAAAATGTGGTGACCTTGAAGAAGAACTCAAGAATGTTACTAACAATCTGAAATCTCTGGAGGCTGCGTCTGAAAAGTATTCTGAAAAGGAG