Transcript asmbl_9794

Sequence
Transcript Sequence for observation asmbl_9794 of TGE0057118:
CGGGGGCAGCCTCCCGGCCCGGCACCAGGTGCATGGCTCGAGGCTACGCCTGCTCCAGGTGACCCCAGCTGATTCAGGGGAGTACGTGTGCCGTGTGGTCGGCAGCTCAGGTACCCAGGAAGCCTCAGTCCTTGTCACCATCCAGCAGCGCCTTAGTGGCTCCCACTCCCAGGGTGTGGCGTACCCCGTCCGCATCGAGTCCTCCTCAGCCTCCCTGGCCAATGGACACACCCTGGACCTCAACTGCCTGGTTGCCAGCCAGGCTCCCCACACCATCACCTGGTATAAGCGTGGAGGCAGCTTACCCAGCCGGCACCAGATCGTGGGCTCCCGGCTGCGGATCCCTCAGGTGACTCCGGCAGACTCGGGCGAGTACGTGTGTCACGTCAGTAACGGTGCAGGCTCCCGGGAGACCTCGCTCATCGTCACCATCCAGGGCAGCGGTTCCTCCCACGTGCCCAGCGTCTCCCCACCGATCAGGATCGAGTCGTCTTCCCCCACGGTGGTGGAAGGGCAGACCTTGGATCTGAACTGCGTGGTCGCCAGGCAGCCCCAGGCTATCATCACATGGTACAAGCGTGGGGGCAGCCTTCCCTCCCGACACCAGACCCATGGCTCCCACCTGCGGTTGCACCAAATGTCTGTGGCTGACTCGGGCGAGTATGTGTGCCGGGCCAACAACAACATCGATGCCCTGGAGGCCTCCATCGTCATCTCCGTCTCCCCTAGCGCCGGCAGCCCCTCCGCCCCTGGCAGCTCCATGCCCATCAGAATTGAGTCATCCTCCTCACACGTGGCCGAAGGGGAGACCCTGGATCTGAACTTGCGTGGTGCCCGGGCAGGCCCACGCCCAGGTCACGTGGCACAAGCGTGGAGGAAACCTCCCTGCCCGGCACCAGGTCCACGGCCCACTGCTGAGGCTGAACCAGGTGTCCCCGGCTGACTCTGGCGAGTACTCGTGCCAAGTGACCGGAAGCTCAGGCACCCTGGAGGCATCTGTCCTGGTCACAATTGAGCCCTCCAGCCCAGGACCCATTCCTGCTCCAGGACTGGCCCAGCCCATCTACATCGAGGCCTCCTCTTCACACGTGACTGAAGGGCAGACTCTGGATCTGAACTGTGTGGTGCCCGGGCAGGCCCATGCCCAGGTC