Transcript asmbl_9791

Sequence
Transcript Sequence for observation asmbl_9791 of TGE0057115:
CCAGGTGCATGGCTCGAGGCTACGCCTGCTCCAGGTGACCCCAGCTGATTCAGGGGAGTACGTGTGCCGTGTGGTCGGCAGCTCAGGTACCCAGGAAGCCTCAGTCCTTGTCACCATCCAGCAGCGCCTTAGTGGCTCCCACTCCCAGGGTGTGGCGTACCCCGTCCGCATCGAGTCCTCCTCAGCCTCCCTGGCCAATGGACACACCCTGGACCTCAACTGCCTGGTTGCCAGCCAGGCTCCCCACACCATCACCTGGTATAAGCGTGGAGGCAGCTTACCCAGCCGGCACCAGATCGTGGGCTCCCGGCTGCGGATCCCTCAGGTGACTCCGGCAGACTCGGGCGAGTACGTGTGTCACGTCAGTAACGGTGCAGGCTCCCGGGAGACCTCGCTCATCGTCACCATCCAGGGCAGCGGTTCCTCCCACGTGCCCAGCGTCTCCCCACCGATCAGGATCGAGTCGTCTTCCCCCACGGTGGTGGAAGGGCAGACCTTGGATCTGAACTGCGTGGTCGCCAGGCAGCCCCAGGCTATCATCACATGGTACAAGCGTGGGGGCAGCCTTCCCTCCCGACACCAGACCCATGGCTCCCACCTGCGGTTGCACCAAATGTCTGTGGCTGACTCGGGCGAGTATGTGTGCCGGGCCAACAACAACATCGATGCCCTGGAGGCCTCCATCGTCATCTCCGTCTCCCCTAGCGCCGGCAGCCCCTCCGCCCCTGGCAGCTCCATGCCCATCAGAATTGAGTCATCCTCCTCACACGTGGCCGAAGGGGAGACCCTGGATCTGAACTGCGTGGTCCCCGGGCAGGCCCATGCCCAGGTCACGTGGCACAAGCGTGGAGGAAACCTCCCTGCCCGGCACCAGGTCCACGGCCCACTGCTGAGGCTGAACCAGGTGTCCCCGGCTGACTCTGGCGAGTACTCGTGCCAAGTGACCGGAAGCTCAGGCACCCTGGAGGCATCTGTCCTGGTCACAATTGAGCCCTCCAGCCCAGGACCCATTCCTGCTCCAGGACTGGCCCAGCCCATCTACATCGAGGCCTCCTCTTCACACGTGACTGAAGGGCAGACTCTGGATCTGAACTGTGTGGTGCCCGGGCAGGCCCATGCCCAGGTC