Transcript asmbl_9790

Sequence
Transcript Sequence for observation asmbl_9790 of TGE0057114:
GGCCGCGCTGTCCCGAGCTGGCCGGCGAGCGGGCGGCTGCGGGCGGCGCGGAGCGGGCGGCGCGGAGCGAGCGAGCGAGAGAGCGGCGCGGGCCGGGCCATGGGGTGGCGGGCGGCGGGCGCGCTGCTGCTGGCGCTGCTGCTGCACGGGCGGCTGCTGGCGGTGACCCATGGGCTGAGGGCATACGATGGCTTGTCTCTGCCTGAGGACATAGAGACCGTCACAGCAAGCCAAATGCGCTGGACACATTCGTACCTTTCTGATGATGAGGACATGCTGGCTGACAGCATCTCAGGAGACGACCTGGGCAGTGGGGACCTGGGCAGCGGGGACTTCCAGATGGTTTATTTCCGAGCCCTGGTGAATTTCACTCGCTCCATCGAGTACAGCCCTCAGCTGGAGGATGCAGGCTCCAGAGAGTTCCGAGAGGTGTCCGAGGCTGTGGTAGACACGCTGGAGTCGGAGTACTTGAAAATTCCCGGAGACCAGGTTGTCAGTGTGGTGTTCATCAAGGAGCTGGATGGCTGGGTTTTTGTGGAGCTGGATGTGGGCTCGGAAGGGAATGCGGATGGGGCTCAGATTCAGGAGATGCTGCTCAGGGTCATCTCCAGCGGCTCTGTGGCCTCCTACGTCACCTCTCCCCAGGGATTCCAGTTCCGACGCCTGGGCACAGTGCCCCAGTTCCCAAGAGCCTGCACGGAGGCCGAGTTTGCCTGCCACAGCTACAATGAGTGTGTGGCCCTGGAGTATCGCTGTGACCGGCGGCCCGACTGCAGGGACATGTCTGATGAGCTCAATTGTGAGGAGCCAGTCCTGGGTATCAGCCCCACATTCTCTCTCCTTGTGGAGACGACATCTTTACCGCCCCGGCCAGAGACAACCATCATGCGACAGCCACCAGTCACCCACGCTCCTCAGCCCCTGCTTCCCGGTTCCGTCAGGCCCCTGCCCTGTGGGCCCCAGGAGGCCGCATGCCGCAATGGGCACTGCATCCCCAGAGACTACCTCTGCGACGGACAGGAGGACTGCGAGGACGGCAGCGATGAGCTAGACTGTGGCCCCCCGCCACCCTGTGAGCCCAACGAGTTCCCCTGCGGGAATGGACATTGTGCCCTCAAGCTGTGGCGCTGCGATGGTGACTTTGACTGTGAGGACCGAACTGATGAAGCCAACTGCCCCACCAAGCGTCCTGAGGAAGTGTGCGGGCCCACACAGTTCCGATGCGTCTCTACCAACATGTGCATCCCAGCCAGCTTCCACTGTGACGAGGAGAGCGACTGTCCTGACCGGAGCGACGAGTTTGGCTGCATGCCCCCCCAGGTGGTGACACCTCCCCGGGAGTCCATCCAGGCTTCCCGGGGCCAGACAGTGACCTTCACCTGCGTGGCCATTGGCGTCCCCACCCCCATCATCAATTGGAGGCTCAACTGGGGCCACATCCCCTCTCATCCCAGGGTGACAGTGACCAGCGAGGGTGGCCGTGGCACACTGATCATCCGTGATGTGAAGGAGTCAGACCAGGGTGCCTACACCTGTGAGGCCATGAACGCCCGGGGCATGGTGTTTGGCATTCCTGACGGTGTCCTTGAGCTCGTCCCACAACGAGGCCCCTGCCCTGACGGCCACTTCTACCTGGAGCACAGCGCCGCCTGCCTGCCCTGCTTCTGCTTTGGCATCACCAGCGTGTGCCAGAGCACCCGCCGCTTCCGGGACCAGATCAGGCTGCGCTTTGACCAACCCGATGACTTCAAGGGTGTGAATGTGACAATGCCTGCGCAGCCCGGCACGCCACCCCTCTCCTCCACGCAGCTGCAGATCGACCCATCCCTGCACGAGTTCCAGCTAGTCGACCTGTCCCGCCGCTTCCTCGTCCACGACTCCTTCTGGGCTCTGCCTGAACAGTTCCTGGGCAACAAGGTGGACTCCTATGGCGGCTCCCTGCGTTACAACGTGCGCTACGAGTTGGCCCGTGGCATGCTGGAGCCAGTGCAGCGGCCGGACGTGGTCCTCATGGGTGCCGGGTACCGCCTCCTCTCCCGAGGCCACACACCCACCCAACCTGGTGCTCTGAACCAGCGCCAGGTCCAGTTCTCTGAGGAGCACTGGGTCCATGAGTCTGGCCGGCCGGTGCAGCGCGCGGAGCTGCTGCAGGTGCTGCAGAGCCTGGAGGCCGTGCTCATCCAGACCGTGTACAACACCAAGATGGCCAGCGTGGGACTTAGCGACATCGCCATGGATACCACCGTCACCCATGCCACCAGCCATGGCCGTGCCCACAGTGTGGAGGAGTGCAGATGCCCCATTGGCTATTCTGGCTTGTCCTGCGAGAGCTGTGATGCCCACTTCACTCGGGTGCCTGGTGGGCCCTACCTGGGCACCTGCTCTGGTTGCAATTGCAATGGCCATGCCAGCTCCTGTGACCCTGTGTATGGCCACTGCCTGAATTGCCAGCACAACACGGAGGGGCCACAGTGCAACAAGTGCAAGGCTGGCTTCTTTGGGGACGCCATGAAGGCCACGGCCACTTCCTGCCGGCCCTGCCCTTGCCCATACATCGATGCCTCCCGCAGATTCTCAGACACTTGCTTCCTGGACACGGATGGCCAAGCCACATGTGACGCCTGTGCCCCAGGCTACACTGGCCGCCGCTGTGAGAGCTGTGCCCCCGGATACGAGGGCAACCCCATCCAGCCCGGCGGGAAGTGCAGGCCCGTCAACCAGGAGATTGTGCGCTGTGACGAGCGTGGCAGCATGGGGACCTCCGGGGAGGCCTGCCGCTGTAAGAACAATGTGGTGGGGCGCTTGTGCAATGAATGTGCTGACGGCTCTTTCCACCTGAGTACCCGAAACCCCGATGGCTGCCTCAAGTGCTTCTGCATGGGTGTCAGTCGCCACTGCACCAGCTCTTCATGGAGCCGTGCCCAGTTGCATGGGGCCTCTGAGGAGCCTGGTCACTTCAGCCTGACCAACGCCGCAAGCACCCACACCACCAACGAGGGCATCTTCTCCCCCACGCCCGGGGAACTGGGATTCTCCTCCTTCCACAGACTCTTATCTGGACCCTACTTCTGGAGCCTCCCTTCACGCTTCCTGGGGGACAAGGTGACCTCCTATGGAGGAGAGCTGCGCTTCACAGTGACCCAGAGGTCCCAGCCGGGCTCCACACCCCTGCACGGGCAGCCGTTGGTGGTGCTGCAAGGTAACAACATCATCCTAGAGCACCATGTGGCCCAGGAGCCCAGCCCCGGCCAGCCCAGCACCTTCATTGTGCCTTTCCGGGAGCAAGCATGGCAGCGGCCCGATGGGCAGCCAGCCACACGGGAGCACCTGCTGATGGCACTGGCAGGCATCGACACCCTCCTGATCCGAGCATCCTACGCCCAGCAGCCCGCTGAGAGCAGGGTCTCTGGCATCAGCATGGACGTGGCTGTGCCCGAGGAAACCGGCCAGGACCCCGCGCTGGAAGTGGAACAGTGCTCCTGCCCACCCGGGTACCGTGGGCCGTCCTGCCAGGACTGTGACACAGGCTACACACGCACGCCCAGTGGCCTCTACCTGGGTACCTGTGAACGCTGCAGCTGCCATGGCCACTCAGAGGCCTGCGAGCCAGAAACAGGTGCCTGCCAGGGCTGCCAGCATCACACGGAGGGCCCTCGGTGTGAGCAGTGCCAGCCAGGATACTACGGGGACGCCCAGCGGGGGACACCACAGGACTGCCAGCTGTGCCCCTGCTACGGAGACCCTGCTGCCGGCCAGGCTGCCCACACTTGTTTTCTGGACACAGACGGCCACCCCACCTGTGATGCGTGCTCCCCAGGCCACAGTGGGCGTCACTGTGAGAGGTGCGCCCCTGGCTACTATGGCAACCCCAGCCAGGGCCAGCCATGCCAGAGAGACAGCCAGGTGCCAGGGCCCATAGGCTGCAACTGTGACCCCCAAGGCAGCGTCAGCAGCCAGTGTGATGCTGCTGGTCAGTGCCAGTGCAAGGCCCAGGTGGAAGGCCTCACTTGCAGCCACTGCCGGCCCCACCACTTCCACCTGAGTGCCAGCAACCCAGACGGCTGCCTGCCCTGCTTCTGTATGGGCATCACCCAGCAGTGCGCCAGCTCTGCCTACACACGCCACCTGATCTCCACCCACTTTGCCCCTGGGGACTTCCAAGGCTTTGCCCTGGTGAACCCACAGCGAAACAGCCGCCTGACAGGAGAATTCACTGTGGAACCCGTGCCCGAGGGTGCCCAGCTCTCTTTTGGCAACTTTGCCCAACTCGGCCATGAGTCCTTCTACTGGCAGCTGCCGGAGACATACCAGGGAGACAAGGTGGCGGCCTACGGTGGGAAGTTGCGATACACCCTCTCCTACACAGCAGGCCCACAGGGCAGCCCACTCTCTGACCCCGATGTGCAGATCACGGGCAACAACATCATGCTAGTGGCCTCCCAGCCAGCGCTGCAGGGCCCTGAGAGGAGGAGCTACGAGATCATGTTCCGAGAGGAATTCTGGCGCCGGCCCGATGGGCAGCCGGCCACACGCGAGCACCTCCTGATGGCACTGGCCGACCTGGATGAGCTCCTGATCCGGGCCACGTTCTCCTCCGTGCCGCTGGCGGCCAGCATCAGCGCAGTCAGCCTGGAGGTCGCCCAGCCGGGGCCCTCAAACAGACCCCGCGCCCTCGAGGTGGAGGAGTGCCGCTGCCCGCCAGGCTACATCGGTCTGTCCTGCCAGGACTGTGCCCCCGGCTACACGCGCACCGGGAGTGGGCTCTACCTCGGCCACTGCGAGCTATGTGAATGCAATGGCCACTCAGACCTGTGCCACCCAGAGACTGGGGCCTGCTCGCAATGCCAGCACAACGCCGCAGGGGAGTTCTGCGAGCTTTGTGCCCCTGGCTACTACGGAGATGCCACAGCCGGGACGCCTGAGGACTGCCAGCCCTGTGCCTGCCCACTGACCAACCCAGAGAACATGTTTTCCCGCACCTGTGAGAGCCTGGGAGCCGGCGGGTACCGCTGCACGGCCTGCGAACCCGGCTACACTGGCCAGTACTGTGAGCAGTGTGGCCCAGGTTACGTGGGTAACCCCAGTGTGCAAGGGGGCCAGTGCCTGCCAGAGACAAACCAAGCCCCACTGGTGGTCGAGGTCCATCCTGCTCGAAGCATAGTGCCCCAAGGTGGCTCCCACTCCCTGCGGTGTCAGGTCAGTGGGAGCCCACCCCACTACTTCTATTGGTCCCGTGAGGATGGGCGGCCTGTGCCCAGCGGCACCCAGCAGCGACATCAAGGCTCCGAGCTCCACTTCCCCAGCGTCCAGCCCTCGGATGCTGGGGTCTACATTTGCACCTGCCGTAATCTCCACCAATCCAATACCAGCCGGGCAGAGCTGCTGGTCACTGAGGCTCCAAGCAAGCCCATCACAGTGACTGTGGAGGAGCAGCGGAGCCAGAGCGTGCGCCCCGGAGCTGACGTCACCTTCATCTGCACAGCCAAAAGCAAGTCCCCAGCCTATACCCTGGTGTGGACCCGCCTGCACAACGGGAAACTGCCCACCCGAGCCATGGATTTCAATGGCATCCTGACCATTCGCAACGTCCAGCTGAGTGATGCAGGCACCTACGTGTGCACCGGCTCCAACATGTTTGCCATGGACCAGGGCACAGCCACTCTACATGTGCAGGCCTCGGGCACCTTGTCCGCCCCCGTGGTCTCCATCCATCCGCCACAGCTCACAGTGCAGCCCGGGCAACTGGCGGAGTTCCGCTGCAGCGCCACAGGGAGCCCCACGCCCACCCTCGAGTGGACAGGGGGCCCCGGCGGCCAGCTCCCTGCGAAGGCACAAATCCACGGCGGCATCCTGCGCCTGCCAGCTGTCGAGCCCACGGATCAGGCCCAGTACTTGTGCCGAGCCCACAGCAGCGCTGGGCAGCAGGTGGCCAGGGCTGTGCTCCACGTGCATGGGGGCGGTGGGCCCAGAGTCCAAGTGAGCCCAGAGAGGACCCAGGTCCACGCAGGCCGCACCGTCAGGCTGTACTGCAGGGCTGCAGGCGTGCCTAGCGCCACCATCACCTGGAGGAAGGAAGGGGGCAGCCTCCCACCACAGGCCCGGTCAGAGCGCACAGACATCGCGACACTGCTCATCCCAGCCATCACGACTGCTGACGCCGGCTTCTACCTCTGCGTGGCCACCAGCCCTGCAGGCACTGCCCAGGCCCGGATCCAAGTGGTTGTCCTTTCAGCCTCAGATGCCAGCCCACCGCCGGTCAAGATTGAGTCCTCATCGCCTTCTGTGACAGAAGGGCAAACACTCGACCTCAACTGTGTGGTGGCAGGGTCAGCCCATGCCCAGGTCACCTGGTACAGGCGAGGGGGTAGCCTGCCTCCCCACACCCAGGTGCACGGCTCCCGTCTGCGGCTCCCCCAGGTCTCACCAGCTGATTCTGGAGAATATGTGTGCCGTGTGGAGAATGGATCGGGCCCCAAGGAGGCCTCCATTACTGTGTCTGTGCTCCACGGCACCCATTCTGGCCCCAGCTACACCCCAGTGCCCGGCAGCACCCGGCCCATCCGCATCGAGCCCTCCTCCTCACACGTGGCGGAAGGGCAGACCCTGGATCTGAACTGCGTGGTGCCCGGGCAGGCCCACGCCCAGGTCACGTGGCACAAGCGTGGGGGCAGCCTCCCTGCCCGGCACCAGGTCCACGGCCCACTGCTGAGGCTGAACCAGGTGTCCCCGGCTGACTCTGGCGAGTACTCGTGCCAAGTGACCGGAAGCTCAGGCACCCTGGAGGCATCTGTCCTGGTCACAATTGAGCCCTCCAGCCCAGGACCCATTCCTGCTCCAGGACTGGCCCAGCCCATCTACATCGAGGCCTCCTCTTCACACGTGACTGAAGGGCAGACTCTGGATCTGAACTGTGTGGTGCCCGGGCAGGCCCATGCCCAGGTC