Transcript asmbl_9786

Sequence
Transcript Sequence for observation asmbl_9786 of TGE0057110:
CCAGACCCACGGCTCCCTGCTGAGACTCTACCAAGCGTCCCCCGCCGACTCGGGCGAGTACGTGTGCCGAGTGTTGGGCAGCTCCGTGCCTCTAGAGGCCTCTGTCCTGGTCACCATTGAGCCTGCGGGCTCAGTGCCTGCACTTGGGGTCACCCCCACGGTCCGGATCGAGTCATCGTCTTCGCAAGTGGCCGAGGGGCAGACCCTGGACCTGAACTGCCTCGTTGCTGGTCAGGCCCATGCCCAGGTCACGTGGCACAAGCGCGGGGGCAGCCTCCCGGCCCGGCACCAGACCCATGGCTCCCAGCTGCGGCTCCACCTCGTCTCCCCTGCCGACTCAGGCGAGTATGTGTGTCGTGCAGCCAGCGGCCCAGGCCCTGAGCAAGAAGCCTCCTTCACAGTCACCGTCCCGCCCAGTGAGGGGTCTTCCTACCGCCTTAGGAGCCCGGTCATCTCCATCGACCCGCCCAGCAGCACCGTGCAGCAGGGCCAGGATGCCAGCTTCAAGTGCCTCATCCATGACGGGGCAGCCCCCATCAGCCTCGAGTGGAAGACCCGGAACCAGGAGCTGGAGGACAACGTCCACATCAGTCCCAATGGCTCCATCATCACCATCGTGGGCACCCGGCCCAGCAACCACGGTACCTACCGCTGCGTGGCCTCCAATGCCTACGGTGTGGCCCAGAGTGTGGTGAACCTCAGTGTGCACGGGCCCCCTACAGTGTCCGTGCTCCCCGAGGGCCCCGTGTGGGTGAAAGTGGGAAAGGCTGTCACCCTGGAGTGTGTCAGTGCCGGGGAGCCCCGCTCCTCTGCTCGTTGGACCCGGATCAGCAGCACCCCTGCCAAGTTGGAGCAGCGGACATATGGGCTCATGGACAGCCACGCGGTGCTGCAGATTTCATCAGCTAAACCATCAGATGCGGGCACTTATGTGTGCCTTGCTCAGAATGCACTAGGCACAGCACAGAAGCAGGTGGAGGTGATCGTGGACACGGGCGCCATGGCCCCAGGGGCCCCTCAGGTCCAAGCTGAAGAAGCTGAGCTGACTGTGGAGGCTGGACACACGGCCACCTTGCGCTGCTCAGCCACAGGCAGCCCCGCGCCCACCATCCACTGGTCCAAGCTGCGTTCCCCACTGCCCTGGCAGCACCGGCTGGAAGGTGACACACTCATCATACCCCGGGTAGCCCAGCAGGACTCGGGCCAGTACATCTGCAATGCCACTAGCCCTGCTGGGCACGCTGAGGCCACCATCATCCTGCACGTGGAGAGCCCACCATATGCCACCACGGTCCCAGAGCACGCTTCGGTGCAGGCAGGGGAGACGGTGCAGCTCCAGTGCCTGGCTCACGGGACACCCCCACTCACCTTCCAGTGGAGCCGCGTGGGCAGCAGCCTTCCTGGGAGGGCGACCGCCAGGAACGAGCTGCTGCACTTTGAGCGTGCAGCCCCTGAGGACTCAGGCCGCTACCGCTGCCGGGTCACCAACAAGGTGGGCTCAGCCGAGGCCTTTGCCCAGCTGCTCGTCCAAGGCCCTCCCGGCTCTCTCCCTGCCACCTCCATCCCAGCAGGGTCCACGCCCACCGTGCAGGTCACGCCTCAGCTAGAGACCAAGAGCATTGGGGCCAGCGTTGAGTTCCACTGTGCTGTGCCCAGCGACCGGGGTACCCAGCTCCGTTGGTTCAAGGAAGGGGGTCAGCTGCCTCCGGGTCACAGCGTGCAGGATGGGGTGCTCCGAATCCAGAACTTGGACCAGAGCTGCCAAGGGACGTATATATGCCAGGCCCATGGACCTTGGGGGAAGGCCCAGGCCAGTGCCCAGCTGGTTATCCAAGCCCTGCCCTCGGTGCTCATCAACATCCGGACCTCTGTGCAGACCGTGGTGGTTGGCCACGCCGTGGAGTTCGAATGCCTGGCACTGGGTGACCCCAAGCCTCAGGTGACATGGAGCAAAGTTGGAGGGCACCTGCGGCCAGGCATTGTGCAGAGCGGAGGTGTCGTCAGGATCGCCCACGTAGAGCTGGCTGATGCGGGACAGTATCGCTGCACTGCCACCAACGCAGCTGGCACCACACAATCCCACGTCCTGCTGCTTGTGCAAGCCTTGCCCCAGATCTCAATGCCCCAAGAAGTCCGTGTGCCTGCTGGTTCTGCAGCTGTCTTCCCCTGCATAGCCTCAGGCTACCCCACTCCTGACATCAGCTGGAGCAAGCTGGATGGCAGCCTGCCACCTGACAGCCGCCTGGAGAACAACATGCTGATGCTGCCCTCAGTCCGACCCCAGGACGCAGGTACCTACGTCTGCACCGCCACTAACCGCCAGGGCAAGGTCAAAGCCTTTGCCCACCTGCAGGTGCCAGAGCGGGTGGTGCCCTACTTCACGCAGACCCCCTACTCCTTCCTACCGCTGCCCACCATCAAGGATGCCTACAGGAAGTTCGAGATCAAGATCACCTTCCGGCCCGACTCAGCCGATGGGATGCTGCTGTACAATGGGCAGAAGCGAGTCCCAGGGAGCCCCACCAACCTGGCCAACCGGCAGCCCGACTTCATCTCCTTCGGCCTCGTGGGGGGAAGGCCCGAGTTCCGGTTCGATGCAGGCTCAGGCATGGCCACCATCCGCCATCCCACACCACTGGCCCTGGGCCATTTCCACACCGTGACCCTGCTGCGCAGCCTCACCCAGGGCTCCCTGATTGTGGGTGACCTGGCCCCGGTCAATGGGACCTCCCAGGGCAAGTTCCAGGGCCTGGATCTGAACGAGGAACTCTACCTGGGTGGCTATCCTGACTATGGTGCCATCCCCAAGGCGGGGCTGAGCAGCGGCTTCATAGGCTGTGTCCGGGAGCTGCGCATCCAGGGCGAGGAGATCGTCTTCCATGACCTCAACCTCACGGCGCACGGCATCTCCCACTGCCCCACCTGTCGGGACCGGCCCTGCCAGAATGGCGGTCAGTGCCATGACTCTGAGAGCAGCAGCTACGTGTGCGTCTGCCCAGCTGGCTTCACCGGGAGCCGCTGTGAGCACTCGCAGGCCCTGCACTGCCATCCAGAGGCCTGTGGGCCCGACGCCACCTGTGTGAACCGGCCTGACGGTCGAGGCTACACCTGCCGCTGCCACCTGGGCCGCTCGGGGTTGCGGTGTGAGGAAGGTGTGACAGTGACCACCCCCTCGCTGTCGGGTGCTGGCTCCTACCTGGCACTGCCCGCCCTCACCAACACACACCACGAGCTACGCCTGGACGTGGAGTTCAAGCCACTCGCCCCTGACGGGGTCCTGCTGTTCAGCGGGGGGAAGAGCGGGCCTGTGGAGGACTTCGTGTCCCTGGCGATGGTGGGCGGCCACCTGGAGTTCCGCTATGAGTTGGGGTCAGGGCTGGCCGTTCTGCGGAGCGCCGAGCCGCTGGCCCTGGGCCGCTGGCACCGTGTGTCTGCAGAGCGTCTCAACAAGGACGGCAGCCTGCGGGTGAATGGTGGACGCCCTGTGCTGCGCTCCTCGCCCGGCAAGAGCCAGGGCCTCAACCTGCACACCCTGCTCTACCTGGGGGGTGTGGAGCCTTCCGTGCCACTGTCCCCGGCCACCAACATGAGCGCTCACTTCCGCGGCTGTGTGGGCGAGGTGTCAGTGAATGGCAAACGGCTGGACCTCACCTACAGTTTCCTAGGCAGCCAGGGCATCGGGCAATGCTATGATAGCTCCCCATGTGAGCGCCAGCCTTGCCAACATGGTGCCACGTGCATGCCCGCTGGCGAGTATGAGTTCCAGTGCCTGTGTCGAGATGGATTCAAAGGAGACCTGTGTGAGCACGAGGAGAACCCCTGCCAGCTCCGTGAACCCTGTCTGCATGGGGGCACCTGCCAGGGCACCCGCTGCCTCTGCCTCCCTGGCTTCTCTGGCCCACGCTGCCAACAAGGCTCTGGACATGGCATAGCAGAGTCCGACTGGCATCTTGAAGGCAGCGGGGGCAATGATGCCCCTGGGCAGTACGGAGCCTATTTCCACGATGATGGCTTCCTCGCCTTCCCTGGCCATGTCTTCTCCAGGAGCCTGCCCGAGGTGCCCGAGACCATCGAGCTGGAGGTTCGGACCAGCACAGCCAGTGGCCTCCTGCTCTGGCAGGGTGTGGAGGTGGGAGAGGCCGGCCAAGGCAAGGACTTCATCAGCCTCGGGCTTCAAGACGGGCACCTTGTCTTCAGGTACCAGCTGGGTAGTGGGGAGGCCCGCCTGGTCTCTGAGGACCCCATCAATGACGGCGAGTGGCACCGGGTGACAGCACTGCGGGAGGGCCGCAGAGGTTCCATCCAAGTCGACGGTGAGGAGCTGGTCAGCGGCCGGTCCCCAGGTCCCAACGTGGCAGTCAACGCCAAGGGCAGCGTCTACATCGGCGGAGCCCCTGACGTGGCCACGCTGACCGGGGGCAGATTCTCCTCAGGCATCACAGGCTGTGTCAAGAACCTGGTGCTGCACTCGGCCCGACCCGGCGCCCCGCCCCCACAGCCCCTGGACCTGCAGCACCGCGCCCAGGCCGGGGCCAACACACGCCCCTGCCCCTCGTAGGCACCTGCCTGCCCCACACGGACTCCCGGGCCACGCCCCAGCCCGACAATGTCGAGTATATTATTATTAATATTATTATGAATTTTTGTAAGAAACCGAGGCGATGCCACGCTTTGCTGCTACCGCCCTGGGCTGGACTGGAGGTGGGCATGCCACCCTCACACACACAGCTGGGCAAAGCCACAAGGCTGGCCAGCAAGGCAGGTTGGATGGGAGTGGGCACCTCAGAAAGTCACCAGGACTTGGGGTCAGGAACAGTGGCTGGGTGGGCCCAGAACTGCCCCCACTGTCCCCCTACCCACCGATGGAGCCCCCAGATAGAGCTGGGTGGCCTGTTTCTGCAGCCCTTGGGCAGTTCTCACTCCTAGGAGAGCCAACCTCGGCTTGTGGGCTGGTGCCCCACAGCTACCTGAGACGGGCATCGCAGGAGTCTCTGCCACCCACTCAGGATTGGGAATTGTCTTTAGTGCCGGCTGTGGAGCAAAAGGCAGCTCACCCCTGGGCAGGCGGTCCCCATCCCCACCAGCTCGTTTTTCAGCACCCCCACCCACCTCCACCCAGCCCCTGGCACCTCCTCTGGCAGACTCCCCCTCCTACCACGTCCTCCTGGCCTGCATTCCCACCCCCTCCTGCCAGCACACAGCCTGGGGTCCCTCCCTCAGGGGCTGTAAGGGAAGGCCCACCCCAACTCTTACCAGGAGCTGCTACAGGCAGAGCCCAGCACTGATAGGGCCCCGCCCACCGGGCCCCGCCCACCCCAGGCCACATCCCCACCCATCTGGAAGTGAAGGCCCAGGGACTCCTCCAACAGACAACGGACGGACGGATGCCGCTGGTGCTCAGGAAGAGCTAGTGCCTTAGGTGGGGGAAGGCAGGACTCACGACTGAGAGAGAGAGGAGGGGGATATGACCACCCTGCCCCATCTGCAGGAGCCTGAAGATCCAGCTCAAGTGCCATCCTGCCAGTGGCCCCCAGACTGTGGGGTTGGGACGCCTGGCCTCTGTGTCCTAGAAGGGACCCTCCTGTGGTCTTTGTCTTGATTTTTCTTAATAAACGGTGCTATCCCCGCCAGGGGCCTCCTGAGTCTTTGATGAGGGCTTCACTCAGTGGAGCCTGTGGATGGGGCAGAGCAGGGCAGGTGAGATCTGGGGGTGAAGCAAGCTGGCTTGGGATCAGCGAGGCCCCCAGGCCCCCAACCCTGTGAGGCAGGAATTGTCCTATTTTCTAGAGGGGCAGCTGAGTCTCAGAGGGTTAGGGGGCCTGTCCAACATCAGACAGAGAGCCAGGGGGTTAGAACCCAAAGAGTCTGACCCCAGAGCCTAGTATCATTCCCATGTGCCCGAAGCCCCTCTAGGGATGGCCTCCCTGATCCTATAAGGCTGGGCCACTCAACTGCAGCCCCCTGGGGAGACCTGGCTGGGACATGGGTAGCACGTGGTACAGGCTGTGCTGCAGTGGAGGCAGAGGCCACGGGCACCAGGTTGCCAGGCCAGCCAGCTGGGAGAGCAACAGCACCAGAGGAGGCCCAGGAGGAGGCCAGCAGAGGCCAGGAGCATCGAGGAGGCCAGCGCCACCCCTCAGAGCTGGGGGCCTGTGGGAAGAGAAAGTCCACTCAGGCCTCGGCCTGGGTCCTCTGCCCCGTCCCCATCACCTAGAGAGGGACAGGTATGATTTTGGTGGGAAGAGTAGGAGCAAGGTGTAACCTTCCAAAGCTGCGTCTTGTCTCGTGGGGTCCCTGCCTGCTGGGGAACTCCTCTCAGCTGCAATCCAGAGGGATCCTGCAGACCCGAGAGCTGGGGAGGGAGTCAGGGATCTGGAGGTATGGGCATCTGTACTTCCTGTCTGGCTGGGCACCGGAGAGGGACCTGCATGGGAAAGAACAGAACTAGCACACTGAGAACTGCCCTTTCTGGGACACTTGTGTGTTTCATTCAATCCTCACAAGACTTCCCTGAGTTTGTCACTCTGTGTTTCCATTTTACAGAGAGGTTGTCACTTGCCGAGTTCAATTAGCTGGAAGTGATAGGAGGACTTGAACTCACATGGTCTGGCTCCAGGGCCTAAGGTCTATGAGTGGAGCTACTTCCCAAGGAAGAGGGTGTACATGTACTGAGCATTGAGGCAGGGTCTCACTCTGTCG