Transcript asmbl_9756

Sequence
Transcript Sequence for observation asmbl_9756 of TGE0001588:
CTTCCGGCGGCGCTCTCCGCGCCTTATCGCCAAAGCTGCGGCTCTGGACGCCCAGCCGCGGCGTATCCCGATCACTTCCGGGTAGTGCTCCACGGGCACGAGCCGCGATTGGGCTACCGTAGATGGGGTACTTCCGGTGTGCACGTGCTGGGTCCTTCGGCAGGAGGAGGAAGATGGAGCCCAGCACCGCGGCCCGGGCTTGGGCCCTCTTTTGGTTGCTGCTGCCCTTGCTTGGCGCGGTTTGCGCCAGCGGACCCCGCACCTTAGTGCTGCTGGACAACCTCAACGTGCGGGAGACTCATTCGCTTTTCTTCCGGAGCCTGAAGGACCGGGGCTTTGAGCTCACATTCAAGACCGCTGATGACCCCAGCCTGTCTCTCATAAAGTATGGGGAATTCCTCTATGACAATCTCATCATTTTCTCCCCTTCGGTAGAAGATTTTGGAGGCAACATCAACGTGGAGACCATCAGTGCCTTTATTGACGGCGGAGGCAGTGTGCTGGTAGCTGCCAGCTCCGACATTGGTGACCCTCTTCGAGAGCTGGGCAGTGAGTGCGGGATTGAGTTTGACGAGGAGAAAACGGCTGTCATTGACCATCACAACTATGACATCTCAGACCTTGGCCAGCATACGCTCATCGTGGCTGACACTGAGAACCTGCTGAAGGCCCCAACCATCGTTGGGAAATCATCTCTAAATCCCATCCTCTTTCGAGGTGTTGGGATGGTGGCCGATCCTGATAACCCTTTGGTGCTGGACATCCTGACGGGCTCTTCCACCTCTTACTCCTTCTTCCCGGACAAGCCTATCACCCAGTATCCACATGCGGTGGGGAAGAACACCCTCCTCATTGCTGGGCTCCAGGCCAGGAACAATGCCCGCGTCATCTTCAGCGGCTCCCTCGACTTCTTCAGCGACTCCTTCTTCAACTCAGCAGTGCAGAAGGCGGCGCCCGGCTCCCAGAGGTATTCCCAGACAGGCAACTATGAACTAGCTGTGGCCCTCTCCCGCTGGGTGTTCAAGGAGGAGGGTGTCCTCCGTGTGGGGCCTGTGTCCCATCATCGGGTGGGCGAGACAGCCCCACCCAATGCCTACACTGTCACTGACCTAGTGGAGTATAGCATCGTGATCCAGCAGCTCTCAAATGGCAAATGGGTCCCCTTTGATGGCGATGACATTCAGCTGGAGTTTGTCCGCATTGATCCTTTTGTGAGGACCTTCCTGAAGAAGAAAGGTGGCAAATACAGTGTTCAGTTCAAGTTGCCCGACGTGTATGGTGTATTCCAGTTTAAAGTGGATTACAACCGGCTAGGCTACACACACCTGTACTCTTCCACTCAGGTATCCGTGCGGCCACTCCAGCACACGCAGTATGAGCGCTTCATCCCCTCGGCCTACCCCTACTACGCCAGCGCCTTCTCCATGATGCTGGGGCTCTTCATCTTCAGCATCGTCTTCTTGCACATGAAGGAGAAGGAGAAGTCCGACTGAGGGGCTAGAGCCCTCTCCGCACAGCGTGGAGACGGGGCAAGGAGGGGGGTTATTAGGATTGGTGGTTTTGTTTTGCTTTGTTTAAAGCCGTGGGAAAATGGCACAACTTTACCTCTGTGGGAGATGCAACACTGAGAGCCAAGGGGTGGGAGTTGGGATAATTTTTATATAAAAGAAGTTTTTCCACTTTGAATTGCTAAAAGTGGCATTTTTCCTATGTGCAGTCACTCCTCTCATTTCTAAAATAGGGACGTGGCCAGGCACGGTGGCTCATGCCTGTAAT