Transcript asmbl_92959

Sequence
Transcript Sequence for observation asmbl_92959 of TGE0057109:
AAAACTGCCAGAGGGTCTCAAGGCAGGCAAAGAAGAACCATGAGGCTCATCCTGCCTGTGGGTTTGATTGCTACCACTCTTGCAATTGCTCCTGTCCGCTTTGACAGGGAGAAGGTGTTCCGCGTGAAGCCCCAGGATGAAAAACAAGCAGACATCATAAAGGACTTGGCCAAAACCAATGAGCTTGACTTCTGGTATCCAGGTGCCACCCACCACGTAGCTGCTAATATGATGGTGGATTTCCGAGTTAGTGAGAAGGAATCCCAAGCCATCCAGTCTGCCTTGGATCAAAATAAAATGCACTATGAAATCTTGATTCATGATCTACAAGAAGAGATTGAGAAACAGTTTGATGTTAAAGAAGATATCCCAGGCAGGCACAGCTACGCAAAATACAATAATTGGGAAAAGATTGTGGCTTGGACTGAAAAGATGATGGATAAGTATCCTGAAATGGTCTCTCGTATTAAAATTGGATCTACTGTTGAAGATAATCCACTATATGTTCTGAAGATTGGGGAAAAGAATGAAAGAAGAAAGGCTATTTTTACGGATTGTGGCATTCACGCACGAGAATGGGTCTCCCCAGCATTCTGCCAGTGGTTTGTCTATCAGGCAACCAAAACTTATGGGAGAAACAAAATTATGACCAAACTCTTGGACCGAATGAATTTTTACATTCTTCCTGTGTTCAATGTTGATGGATATATTTGGTCATGGACAAAGAACCGCATGTGGAGAAAAAATCGTTCCAAGAACCAAAACTCCAAATGCATCGGCACTGACCTCAACAGGAATTTTAATGCTTCATGGAACTCCATTCCTAACACCAATGACCCATGTGCAGATAACTATCGGGGCTCTGCACCAGAGTCCGAGAAAGAGACGAAAGCTGTCACTAATTTCATTAGAAGCCACCTGAATGAAATCAAGGTTTACATCACCTTCCATTCCTACTCCCAGATGCTATTGTTTCCCTATGGATATACATCAAAACTGCCACCTAACCATGAGGACTTGGCCAAAGTTGCAAAGATTGGCACTGATGTTCTATCAACTCGATATGAAACCCGCTACATCTATGGCCCAATAGAATCAACAATTTACCCGATATCAGGTTCTTCTTTAGACTGGGCTTATGACCTGGGCATCAAACACACATTTGCCTTTGAGCTCCGAGATAAAGGCAAATTTGGTTTTCTCCTTCCAGAATCCCGGATAAAGCCAACGTGCAGAGAGACCATGCTAGCTGTCAAATTTATTGCCAAGTATATCCTCAAGCATACTTCCTAAAGAACTGCCCTCTGTTTGGAATAAGCCAATTAATCCTTTTTTGTGCCTTTCATCAGAAAGTCAATCTTCAGTTATCCCCAAATGCAGCTTCTATTTCACCTGAATCCTTCTCTTGCTCATTTAAGTCCCATGTTACTGCTGTTTGCTTTTACTTACTTTCAGTAGCACCATAACGAAGTAGCTTTAAGTGAAACCTTTTAACTACCTTTCTTTGCTCCAAGTGAAGTTTGGACCCAGCAGAAAGCATTATTTTGAAAGGTGATATACAGTGGGGCACAGAAAACAAATGAAAACCTTCAGTTTCTCACAGATTTTCACCATGTGGCTTCATCAATTTATGTGCTAATACAATAAAATAAAATGCACTTAATGCTTTAAAATTCATCTTTTTATGATAAACTATATTCTCTGTATTTCTCTATAGCATTAATAATCAATATTAATGCCATTCATTCAGTCTGTTAATAAGAAATAATATCTTCAATTTTCAAAAACA