Transcript asmbl_92055

Sequence
Transcript Sequence for observation asmbl_92055 of TGE0057108:
CCGCGCGCACACAGCCAGGGGCCGCCCGGGCTCTCGACGCGCCGACGGCCGGGCGGACGGACGGACGGACGCCGAGCGCAGTGCCCCGCGGGTCTTACAGGAGAGGGGACCGTCCTGGGCTGGCCTGGACCATGGTGCTGCTCTGGGAGCCTGCAGGAGCCTGGCTTGCTCTGGGCCTGGCCCTGGCCCTGGGCCCCAGCGTGGCCGCAGCTGCCCCTCGGCAGGACTGCACGGGCGTGGAGTGCCCGCCGCTGGAGAACTGCATTGAGGAGGCGCTGGAGCCGGGTGCCTGCTGTGCCACGTGTGTGCAGCAGGGCTGCGCCTGCGAGGGCTACCAGTACTATGACTGCCTACAGGGTGGCTTCGTGCGCGGCCGCGTGCCCGCCGGTCAGTCCTATTTTGTGGACTTCGGGAGCACTGAGTGCTCCTGCCCACCAGGCGGCGGCAAGATCAGCTGCCAGTTCATGCTGTGCCCGGAGCTGCCGCCCAACTGCATCGAGGCTGTAGTGGTGGCTGACAGCTGCCCACAGTGCGGCCAGGTGGGCTGCGTCCACGCGGGCCACAAGTACGCCGCTGGCCACACTGTTCACCTGCCGCCCTGCCGGGCCTGCCACTGCCCTGACGCCGGTGGAGAGCTCATCTGCTACCAGCTCCCCGGTTGCCACGGGAACTTCTCAGATGCCGAGGAGGGTGACCCCGAGCGACACTACGAAGACCCCTACAGCTATGACCAGGAGGTGGCCGAGGAGGAGAGGGCAGAAGCTGGGGCAAGGGCAGAAGCTGGGGCAAGGCCTGAAGAGAACCTCATCCTGGATGCCCAAGCCACGTCCCGCAGCACTGGGCCGGAGGGCGTGACGCATGCACCGAGCCTGGGCAAGGCTGCTCTCGTCCCAACTCAGGCCGTGCCTGGCTCTCCCAGGGACCCAGTCAAGCCCAGCCCCCACAACATCCTGTCCACATCACTGCCTGATGCAGCCTGGATCCCACCCACCCGAGAAGTGCCCAGGAAGCCGCAAGTTCTGCCCCATTCCCACGTGGAGGAGGACACAGACCCCAACTCTGTCCATTCTATCCCCAGAAGTAGCCCTGAAGGCTCCACCAAGGACCTGATCGAGACTTGCTGCGCAGCCGGACAGCAGTGGGCCATTGACAATGACGAGTGCCTGGAGATCCCTGAGAGTGGCACTGAGGACAACGTCTGCAGGACAGCCCAGAGGCACTGCTGTGTCTCCTACTTGCAGGAGAAGAGCTGCATGGCCGGCGTCCTGGGAGCCAAGGAGGGTGAGACCTGTGGGGCTGAGGACAACGACAGCTGCGGCATCTCCCTGTACAAGCAATGCTGTGACTGCTGTGGCCTGGGCCTCCGCGTGCGGGCCGAGGGCCAGTCGTGTGAGTCCAATCCTAACCTGGGCTATCCCTGCAATCATGTCATGCTCTCCTGCTGTGAGGGTGAAGAGCCTCTCATAGTACCTGAGGTTCGCCGACCTCCAGAGCCCGCAGCTGCACCACGGAGAGTTTCAGAGGCAGAGATGGCGGGCCGAGAGGCCCTGTCACTGGGCACAGAGGCCGAGCTGCCGAACAGCCTGCCGGGCGATGACCAGGATGAGTGCCTTCTCCTCCCGGGAGAGCTGTGCCAGCACCTTTGCATCAATACTGTGGGTTCTTACCACTGTGCCTGCTTTCCTGGCTTCTCACTGCAGGACGATGGCCGCACTTGCCGCCCAGAGGGTCACCCTCCACAGCCGGAAGCCCCACAGGAGCCTGCACTGAAGTCAGAATTTTCCCAGGTGGCCTCTAACACCATCCCGCTGCCACTGCCGCAGCCCAATACCTGCAAAGACAATGGACCCTGCAAGCAGGTGTGCAGCACTGTTGGGGGCTCAGCCATATGCTCCTGTTTTCCCGGCTATGCCATCATGGCGGATGGCGTGTCCTGTGAAGACCAAGACGAGTGCCTGATGGGTGCTCACGATTGTAGCCGGCGACAGTTCTGTGTGAACACCCTGGGATCCTTCTACTGTGTCAACCACACAGTGCTCTGTGCCGATGGCTATATCCTCAATGCGCACAGGAAGTGCGTGGACATCAACGAGTGTGTGACGGACCTGCACACGTGCAGCCGGGGCGAGCACTGTGTGAACACACTGGGCTCCTTCCACTGCTACAAGGCACTCACCTGTGAGCCAGGCTATGCCCTCAAGGATGGCGAGTGCGAAGACGTGGATGAGTGTGCGATGGGCACGCACACCTGCCAGCCGGGCTTCTTGTGCCAGAACACCAAGGGCTCCTTCTACTGCCAGGCCAGGCAGCGCTGCATGGATGGCTTCCTGCAGGATCCTGAAGGCAACTGTGTGGACATCAACGAGTGCACGTCACTGTCCGAGCCATGTCGGCCAGGCTTCAGCTGCATCAACACGGTGGGCTCCTACACATGCCAGAGGAACCCGCTGATCTGCGCGCGCGGCTACCACGCCAGCGATGATGGGACCAAGTGTGTGGACGTGAATGAGTGTGAGACAGGTGTGCACCGCTGCGGTGAGGGCCAAGTGTGCCACAACCTCCCTGGCTCCTACCGCTGTGACTGCAAAGCCGGCTTTCAGCGGGATGCCTTTGGCCGGGGCTGCATCGACGTGAATGAGTGCTGGGCCTCGCCAGGCCGCCTGTGCCAGCACACGTGTGAGAACACACTCGGCTCCTACCGCTGTTCCTGCGCCTCCGGGTTCCTGCTAGCAGCGGACGGCAAGCGCTGTGAAGACGTGAATGAGTGTGAGGCCCAGCGCTGCAGCCAGGAGTGTGCCAACATCTATGGCTCCTACCAGTGCTACTGCCGCCAGGGCTACCAGCTGGCTGAGGATGGGCACACCTGCACAGACATCGACGAGTGTGCTCAAGGCGCCGGCATCCTCTGCACCTTCCGCTGTCTCAACGTGCCAGGGAGCTACCAGTGTGCATGCCCTGAGCAGGGCTACACCATGACGGCCAACGGGAGGTCCTGCAAGGACGTGGATGAGTGTGCACTGGGTACCCACAACTGTTCCGAGGCTGAGACCTGCCACAACATCCAGGGTAGCTTCCGCTGCCTGCGCTTCGAGTGTCCTCCCAACTATGTCCAAGTCTCCAAAACGAAGTGCGAGCGCACCACGTGCCATGACTTCCTGGAGTGCCAGAACTCGCCAGCGCGCATCACGCACTACCAGCTCAACTTCCAGACGGGCCTCCTGGTGCCTGCGCATATCTTCCGCATTGGCCCCGCGCCAGCCTTCACGGGGGACACCATCGCCCTGAACATCATCAAGGGCAATGAGGAGGGCTACTTTGGCACGCGCAGGCTCAATGCCTACACGGGTGTGGTCTACCTGCAGCGGGCCGTGCTGGAGCCCCGGGACTTTGCCCTGGACGTGGAGATGAAGCTCTGGAGGCAGGGCTCCGTCACCACCTTCCTGGCCAAGATGCACATCTTCTTCACCACCTTTGCCCTGTGAGGTGCCAGCACGGGCCACCTGCGGGTGTGGCGCAGCCCAGGGCTCACACTGCGTGGGAGGGACTGGGTCACTATTGTGGTTTTTACTATAACTTTGTAAATTAACTTAATTTTGCTGACTTGACTCCTGTGGCTTCTGGACCCCTCCTCTGCCCCGCAGGAGGAAGTTCCACGGCAGGTGGTGCGTTCCCACGCAGGCACCAAGTGGAAGCTTGCACGGTGGGCCACGGCCGTGGCGGGTGCCCTGTGGGTGAGGCTGGGTGATGACCTGAGGACCAGAGACACGCGACCATGTTGGGGCTCTTGGACTCCTCTGGATGACCCGTCCCCAAAGTTGACATTCCATTTCATGTTCCACTGTGATTAATTCTTTTCTTTTTTAAAAAATCATTTTAAAGTTTTTTGTTTAACTATAAAGTAGTACATGTACATTATATAAAAAAAAGTTCAACTAGTATGAAAGGGTTATAAAGTAACAGAGGAAAACGCC