Transcript asmbl_92054

Sequence
Transcript Sequence for observation asmbl_92054 of TGE0057107:
CCGCGCGCACACAGCCAGGGGCCGCCCGGGCTCTCGACGCGCCGACGGCCGGGCGGACGGACGGACGGACGCCGAGCGCAGTGCCCCGCGGGTCTTACAGGAGAGGGGACCGTCCTGGGCTGGCCTGGACCATGGTGCTGCTCTGGGAGCCTGCAGGAGCCTGGCTTGCTCTGGGCCTGGCCCTGGCCCTGGGCCCCAGCGTGGCCGCAGCTGCCCCTCGGCAGGACTGCACGGGCGTGGAGTGCCCGCCGCTGGAGAACTGCATTGAGGAGGCGCTGGAGCCGGGTGCCTGCTGTGCCACGTGTGTGCAGCAGGGCTGCGCCTGCGAGGGCTACCAGTACTATGACTGCCTACAGGGTGGCTTCGTGCGCGGCCGCGTGCCCGCCGGTCAGTCCTATTTTGTGGACTTCGGGAGCACTGAGTGCTCCTGCCCACCAGGCGGCGGCAAGATCAGCTGCCAGTTCATGCTGTGCCCGGAGCTGCCGCCCAACTGCATCGAGGCTGTAGTGGTGGCTGACAGCTGCCCACAGTGCGGCCAGGTGGGCTGCGTCCACGCGGGCCACAAGTACGCCGCTGGCCACACTGTTCACCTGCCGCCCTGCCGGGCCTGCCACTGCCCTGACGCCGGTGGAGAGCTCATCTGCTACCAGCTCCCCGGTTGCCACGGGAACTTCTCAGATGCCGAGGAGGGTGACCCCGAGCGACACTACGAAGACCCCTACAGCTATGACCAGGAGGTGGCCGAGGTGGAAGCAGCAACAGCCCTGGGGGGTGAGGTCCAGGCGGGTGCAGTCCAGGCAGGCGCAGGGGGCCCCCCAGCTGCTCTGGGAGGTGGGAGTCAGCCACTGTCCACCATCCAGGCACCCCCCTGGCCAGCTGTCCTCCCCAGGCCCACAGCGGCTGCTGCCCTGGGTCCCCCAGCCCCAGTGCAGGCCAAAGCTAGGAGAGTGACCGAGGACAGTGAGGAGGAAGAAGAGGAGGAGGAGGAGAGAGAGGAAATGGCTGTCACTGAGCAGCTGGCAGCAGGTGGCCACAGGGGGCTGGATGGGCTGCCCACTACAGCCCCAGCTGGACCCAGTCTTCCTATCCAGGAGGAGAGGGCAGAAGCTGGGGCAAGGGCAGAAGCTGGGGCAAGGCCTGAAGAGAACCTCATCCTGGATGCCCAAGCCACGTCCCGCAGCACTGGGCCGGAGGGCGTGACGCATGCACCGAGCCTGGGCAAGGCTGCTCTCGTCCCAACTCAGGCCGTGCCTGGCTCTCCCAGGGACCCAGTCAAGCCCAGCCCCCACAACATCCTGTCCACATCACTGCCTGATGCAGCCTGGATCCCACCCACCCGAGAAGTGCCCAGGAAGCCGCAAGTTCTGCCCCATTCCCACGTGGAGGAGGACACAGACCCCAACTCTGTCCATTCTATCCCCAGAAGTAGCCCTGAAGGCTCCACCAAGGACCTGATCGAGACTTGCTGCGCAGCCGGACAGCAGTGGGCCATTGACAATGACGAGTGCCTGGAGATCCCTGAGAGTGGCACTGAGGACAACGTCTGCAGGACAGCCCAGAGGCACTGCTGTGTCTCCTACTTGCAGGAGAAGAGCTGCATGGCCGGCGTCCTGGGAGCCAAGGAGGGTGAGACCTGTGGGGCTGAGGACAACGACAGCTGCGGCATCTCCCTGTACAAGCAATGCTGTGACTGCTGTGGCCTGGGCCTCCGCGTGCGGGCCGAGGGCCAGTCGTGTGAGTCCAATCCTAACCTGGGCTATCCCTGCAATCATGTCATGCTCTCCTGCTGTGAGGGTGAAGAGCCTCTCATAGTACCTGAGGTTCGCCGACCTCCAGAGCCCGCAGCTGCACCACGGAGAGTTTCAGAGGCAGAGATGGCGGGCCGAGAGGCCCTGTCACTGGGCACAGAGGCCGAGCTGCCGAACAGCCTGCCGGGCGATGACCAGGATGAGTGCCTTCTCCTCCCGGGAGAGCTGTGCCAGCACCTTTGCATCAATACTGTGGGTTCTTACCACTGTGCCTGCTTTCCTGGCTTCTCACTGCAGGACGATGGCCGCACTTGCCGCCCAGAGGGTCACCCTCCACAGCCGGAAGCCCCACAGGAGCCTGCACTGAAGTCAGAATTTTCCCAGGTGGCCTCTAACACCATCCCGCTGCCACTGCCGCAGCCCAATACCTGCAAAGACAATGGACCCTGCAAGCAGGTGTGCAGCACTGTTGGGGGCTCAGCCATATGCTCCTGTTTTCCCGGCTATGCCATCATGGCGGATGGCGTGTCCTGTGAAGACCAAGACGAGTGCCTGATGGGTGCTCACGATTGTAGCCGGCGACAGTTCTGTGTGAACACCCTGGGATCCTTCTACTGTGTCAACCACACAGTGCTCTGTGCCGATGGCTATATCCTCAATGCGCACAGGAAGTGCGTGGACATCAACGAGTGTGTGACGGACCTGCACACGTGCAGCCGGGGCGAGCACTGTGTGAACACACTGGGCTCCTTCCACTGCTACAAGGCACTCACCTGTGAGCCAGGCTATGCCCTCAAGGATGGCGAGTGCGAAGACGTGGATGAGTGTGCGATGGGCACGCACACCTGCCAGCCGGGCTTCTTGTGCCAGAACACCAAGGGCTCCTTCTACTGCCAGGCCAGGCAGCGCTGCATGGATGGCTTCCTGCAGGATCCTGAAGGCAACTGTGTGGACATCAACGAGTGCACGTCACTGTCCGAGCCATGTCGGCCAGGCTTCAGCTGCATCAACACGGTGGGCTCCTACACATGCCAGAGGAACCCGCTGATCTGCGCGCGCGGCTACCACGCCAGCGATGATGGGACCAAGTGTGTGGACGTGAATGAGTGTGAGACAGGTGTGCACCGCTGCGGTGAGGGCCAAGTGTGCCACAACCTCCCTGGCTCCTACCGCTGTGACTGCAAAGCCGGCTTTCAGCGGGATGCCTTTGGCCGGGGCTGCATCGACGTGAATGAGTGCTGGGCCTCGCCAGGCCGCCTGTGCCAGCACACGTGTGAGAACACACTCGGCTCCTACCGCTGTTCCTGCGCCTCCGGGTTCCTGCTAGCAGCGGACGGCAAGCGCTGTGAAGACGTGAATGAGTGTGAGGCCCAGCGCTGCAGCCAGGAGTGTGCCAACATCTATGGCTCCTACCAGTGCTACTGCCGCCAGGGCTACCAGCTGGCTGAGGATGGGCACACCTGCACAGACATCGACGAGTGTGCTCAAGGCGCCGGCATCCTCTGCACCTTCCGCTGTCTCAACGTGCCAGGGAGCTACCAGTGTGCATGCCCTGAGCAGGGCTACACCATGACGGCCAACGGGAGGTCCTGCAAGGACGTGGATGAGTGTGCACTGGGTACCCACAACTGTTCCGAGGCTGAGACCTGCCACAACATCCAGGGTAGCTTCCGCTGCCTGCGCTTCGAGTGTCCTCCCAACTATGTCCAAGTCTCCAAAACGAAGTGCGAGCGCACCACGTGCCATGACTTCCTGGAGTGCCAGAACTCGCCAGCGCGCATCACGCACTACCAGCTCAACTTCCAGACGGGCCTCCTGGTGCCTGCGCATATCTTCCGCATTGGCCCCGCGCCAGCCTTCACGGGGGACACCATCGCCCTGAACATCATCAAGGGCAATGAGGAGGGCTACTTTGGCACGCGCAGGCTCAATGCCTACACGGGTGTGGTCTACCTGCAGCGGGCCGTGCTGGAGCCCCGGGACTTTGCCCTGGACGTGGAGATGAAGCTCTGGAGGCAGGGCTCCGTCACCACCTTCCTGGCCAAGATGCACATCTTCTTCACCACCTTTGCCCTGTGAGGTGCCAGCACGGGCCACCTGCGGGTGTGGCGCAGCCCAGGGCTCACACTGCGTGGGAGGGACTGGGTCACTATTGTGGTTTTTACTATAACTTTGTAAATTAACTTAATTTTGCTGACTTGACTCCTGTGGCTTCTGGACCCCTCCTCTGCCCCGCAGGAGGAAGTTCCACGGCAGGTGGTGCGTTCCCACGCAGGCACCAAGTGGAAGCTTGCACGGTGGGCCACGGCCGTGGCGGGTGCCCTGTGGGTGAGGCTGGGTGATGACCTGAGGACCAGAGACACGCGACCATGTTGGGGCTCTTGGACTCCTCTGGATGACCCGTCCCCAAAGTTGACATTCCATTTCATGTTCCACTGTGATTAATTCTTTTCTTTTTTAAAAAATCATTTTAAAGTTTTTTGTTTAACTATAAAGTAGTACATGTACATTATATAAAAAAAAGTTCAACTAGTATGAAAGGGTTATAAAGTAACAGAGGAAAACGCC