Transcript asmbl_92053

Sequence
Transcript Sequence for observation asmbl_92053 of TGE0057106:
CCGCGCGCACACAGCCAGGGGCCGCCCGGGCTCTCGACGCGCCGACGGCCGGGCGGACGGACGGACGGACGCCGAGCGCAGTGCCCCGCGGGTCTTACAGGAGAGGGGACCGTCCTGGGCTGGCCTGGACCATGGTGCTGCTCTGGGAGCCTGCAGGAGCCTGGCTTGCTCTGGGCCTGGCCCTGGCCCTGGGCCCCAGCGTGGCCGCAGCTGCCCCTCGGCAGGACTGCACGGGCGTGGAGTGCCCGCCGCTGGAGAACTGCATTGAGGAGGCGCTGGAGCCGGGTGCCTGCTGTGCCACGTGTGTGCAGCAGGGCTGCGCCTGCGAGGGCTACCAGTACTATGACTGCCTACAGGGTGGCTTCGTGCGCGGCCGCGTGCCCGCCGGTCAGTCCTATTTTGTGGACTTCGGGAGCACTGAGTGCTCCTGCCCACCAGGCGGCGGCAAGATCAGCTGCCAGTTCATGCTGTGCCCGGAGCTGCCGCCCAACTGCATCGAGGCTGTAGTGGTGGCTGACAGCTGCCCACAGTGCGGCCAGGTGGGCTGCGTCCACGCGGGCCACAAGTACGCCGCTGGCCACACTGTTCACCTGCCGCCCTGCCGGGCCTGCCACTGCCCTGACGCCGGTGGAGAGCTCATCTGCTACCAGCTCCCCGGTTGCCACGGGAACTTCTCAGATGCCGAGGAGGGTGACCCCGAGCGACACTACGAAGACCCCTACAGCTATGACCAGGAGGTGGCCGAGGTGGAAGCAGCAACAGCCCTGGGGGGTGAGGTCCAGGCGGGTGCAGTCCAGGCAGGCGCAGGGGGCCCCCCAGCTGCTCTGGGAGGTGGGAGTCAGCCACTGTCCACCATCCAGGCACCCCCCTGGCCAGCTGTCCTCCCCAGGCCCACAGCGGCTGCTGCCCTGGGTCCCCCAGCCCCAGTGCAGGCCAAAGCTAGGAGAGTGACCGAGGACAGTGAGGAGGAAGAAGAGGAGGAGGAGGAGAGAGAGGAAATGGCTGTCACTGAGCAGCTGGCAGCAGGTGGCCACAGGGGGCTGGATGGGCTGCCCACTACAGCCCCAGCTGGACCCAGTCTTCCTATCCAGGAGGAGAGGGCAGAAGCTGGGGCAAGGGCAGAAGCTGGGGCAAGGCCTGAAGAGAACCTCATCCTGGATGCCCAAGCCACGTCCCGCAGCACTGGGCCGGAGGGCGTGACGCATGCACCGAGCCTGGGCAAGGCTGCTCTCGTCCCAACTCAGGCCGTGCCTGGCTCTCCCAGGGACCCAGTCAAGCCCAGCCCCCACAACATCCTGTCCACATCACTGCCTGATGCAGCCTGGATCCCACCCACCCGAGAAGTGCCCAGGAAGCCGCAAGTTCTGCCCCATTCCCACGTGGAGGAGGACACAGACCCCAACTCTGTCCATTCTATCCCCAGAAGTAGCCCTGAAGGCTCCACCAAGGACCTGATCGAGACTTGCTGCGCAGCCGGACAGCAGTGGGCCATTGACAATGACGAGTGCCTGGAGATCCCTGAGAGTGGCACTGAGGACAACGTCTGCAGGACAGCCCAGAGGCACTGCTGTGTCTCCTACTTGCAGGAGAAGAGCTGCATGGCCGGCGTCCTGGGAGCCAAGGAGGGTGAGACCTGTGGGGCTGAGGACAACGACAGCTGCGGCATCTCCCTGTACAAGCAATGCTGTGACTGCTGTGGCCTGGGCCTCCGCGTGCGGGCCGAGGGCCAGTCGTGTGAGTCCAATCCTAACCTGGGCTATCCCTGCAATCATGTCATGCTCTCCTGCTGTGAGGGTGAAGAGCCTCTCATAGTACCTGAGGTTCGCCGACCTCCAGAGCCCGCAGCTGCACCACGGAGAGTTTCAGAGGCAGAGATGGCGGGCCGAGAGGCCCTGTCACTGGGCACAGAGGCCGAGCTGCCGAACAGCCTGCCGGGCGATGACCAGGATGAGTGCCTTCTCCTCCCGGGAGAGCTGTGCCAGCACCTTTGCATCAATACTGTGGGTTCTTACCACTGTGCCTGCTTTCCTGGCTTCTCACTGCAGGACGATGGCCGCACTTGCCGCCCAGAGGGTCACCCTCCACAGCCGGAAGCCCCACAGGAGCCTGCACTGAAGTCAGAATTTTCCCAGGTGGCCTCTAACACCATCCCGCTGCCACTGCCGCAGCCCAATACCTGCAAAGACAATGGACCCTGCAAGCAGGTGTGCAGCACTGTTGGGGGCTCAGCCATATGCTCCTGTTTTCCCGGCTATGCCATCATGGCGGATGGCGTGTCCTGTGAAGACATCAACGAGTGTGTGACGGACCTGCACACGTGCAGCCGGGGCGAGCACTGTGTGAACACACTGGGCTCCTTCCACTGCTACAAGGCACTCACCTGTGAGCCAGGCTATGCCCTCAAGGATGGCGAGTGCGAAGACGTGGATGAGTGTGCGATGGGCACGCACACCTGCCAGCCGGGCTTCTTGTGCCAGAACACCAAGGGCTCCTTCTACTGCCAGGCCAGGCAGCGCTGCATGGATGGCTTCCTGCAGGATCCTGAAGGCAACTGTGTGGACATCAACGAGTGCACGTCACTGTCCGAGCCATGTCGGCCAGGCTTCAGCTGCATCAACACGGTGGGCTCCTACACATGCCAGAGGAACCCGCTGATCTGCGCGCGCGGCTACCACGCCAGCGATGATGGGACCAAGTGTGTGGACGTGAATGAGTGTGAGACAGGTGTGCACCGCTGCGGTGAGGGCCAAGTGTGCCACAACCTCCCTGGCTCCTACCGCTGTGACTGCAAAGCCGGCTTTCAGCGGGATGCCTTTGGCCGGGGCTGCATCGACGTGAATGAGTGCTGGGCCTCGCCAGGCCGCCTGTGCCAGCACACGTGTGAGAACACACTCGGCTCCTACCGCTGTTCCTGCGCCTCCGGGTTCCTGCTAGCAGCGGACGGCAAGCGCTGTGAAGACGTGAATGAGTGTGAGGCCCAGCGCTGCAGCCAGGAGTGTGCCAACATCTATGGCTCCTACCAGTGCTACTGCCGCCAGGGCTACCAGCTGGCTGAGGATGGGCACACCTGCACAGACATCGACGAGTGTGCTCAAGGCGCCGGCATCCTCTGCACCTTCCGCTGTCTCAACGTGCCAGGGAGCTACCAGTGTGCATGCCCTGAGCAGGGCTACACCATGACGGCCAACGGGAGGTCCTGCAAGGACGTGGATGAGTGTGCACTGGGTACCCACAACTGTTCCGAGGCTGAGACCTGCCACAACATCCAGGGTAGCTTCCGCTGCCTGCGCTTCGAGTGTCCTCCCAACTATGTCCAAGTCTCCAAAACGAAGTGCGAGCGCACCACGTGCCATGACTTCCTGGAGTGCCAGAACTCGCCAGCGCGCATCACGCACTACCAGCTCAACTTCCAGACGGGCCTCCTGGTGCCTGCGCATATCTTCCGCATTGGCCCCGCGCCAGCCTTCACGGGGGACACCATCGCCCTGAACATCATCAAGGGCAATGAGGAGGGCTACTTTGGCACGCGCAGGCTCAATGCCTACACGGGTGTGGTCTACCTGCAGCGGGCCGTGCTGGAGCCCCGGGACTTTGCCCTGGACGTGGAGATGAAGCTCTGGAGGCAGGGCTCCGTCACCACCTTCCTGGCCAAGATGCACATCTTCTTCACCACCTTTGCCCTGTGAGGTGCCAGCACGGGCCACCTGCGGGTGTGGCGCAGCCCAGGGCTCACACTGCGTGGGAGGGACTGGGTCACTATTGTGGTTTTTACTATAACTTTGTAAATTAACTTAATTTTGCTGACTTGACTCCTGTGGCTTCTGGACCCCTCCTCTGCCCCGCAGGAGGAAGTTCCACGGCAGGTGGTGCGTTCCCACGCAGGCACCAAGTGGAAGCTTGCACGGTGGGCCACGGCCGTGGCGGGTGCCCTGTGGGTGAGGCTGGGTGATGACCTGAGGACCAGAGACACGCGACCATGTTGGGGCTCTTGGACTCCTCTGGATGACCCGTCCCCAAAGTTGACATTCCATTTCATGTTCCACTGTGATTAATTCTTTTCTTTTTTAAAAAATCATTTTAAAGTTTTTTGTTTAACTATAAAGTAGTACATGTACATTATATAAAAAAAAGTTCAACTAGTATGAAAGGGTTATAAAGTAACAGAGGAAAACGCC