Transcript asmbl_19183

Sequence
Transcript Sequence for observation asmbl_19183 of TGE0001383:
AGTGTAAAGGCCCTTCGGTCTAAGGCTTTCCTATTTCCTGGTTCGCCGGCGGCCATTTTGGGTGGAAGCGATAGCTGAGTGGCGGCGGCTGCTGATTGTGTTCTAAGGGGACGGAGTAGGGGAAGACGTTTGCTCTCCCGGAACAGCTTATCTCATTCTTTTCCTTCGATTACCCGTGGCGCGGAGAATCAGGGCGGCGGCTGCAGCAGCAAGGGCGGCGGTGGCGGCGGCGGCAGCTGCAGTGACATGTCCAGCATGAATCCCGAATATGATTATTTATTCAAGTTACTTCTGATTGGAGACTCTGGAGTTGGAAAGTCTTGCCTCCTTCTTAGATTTGCAGATGATACATATACAGAAAGCTACATCAGCACAATTGGTGTGGATTTCAAAATAAGAACTATAGAGTTAGATGGGAAAACAATCAAGCTTCAAATTTGGGACACAGCGGGCCAAGAAAGATTTCGAACAATCACCTCCAGTTATTACAGAGGAGCGCATGGCATCATAGTTGTGTATGATGTGACAGATCAGGAGTCCTTCAATAACGTTAAACAGTGGCTGCAGGAAATAGATCGTTATGCCAGTGAAAATGTCAACAAGTTGTTGGTAGGGAACAAATGTGATCTGACCACAAAGAAAGTAGTAGACTACACAACAGCAAAGGAATTTGCTGATTCTCTTGGAATTCCATTTTTGGAAACCAGTGCTAAAAACGCAACGAATGTAGAACAATCTTTCATGACGATGGCAGCTGAGATTAAAAAGCGAATGGGTCCTGGAGCAACAGCTGGTGGTGCAGAAAAGTCCAATGTTAAAATTCAGAGCACTCCGGTCAAGCAGTCAGGTGGAGGTTGCTGCTAAAATTTGCCTCCGTCCTTTTCTCACAGCAGTGAATTTGCAATCTGAACCCAAGTGAAAACAAAATTGCCTGAATTGTACTGTATGTAGCTGCACTACAACAGATTCTTACCGTCTCCACAAAGGTCAGAGATTGTAAATGGTCAATACTGACTTTTTTTTTATTCCCTTGACTCAAGACAGCTAACTTCATTTTCAGAACCGTTTTAAACCTTTGTGTGCTGGTTTATAAAATAATGTGTGTAATCCTTGTTGCTTTCCTGATACCAGACTGTTTCCCGTGGTTGGTTAGAATATATTTTGTTTTGATGTTTCTATTGGCATGTTTAGATGTCAGGTTTAGTCTTCTGAAGATGAAGTTCAGCCATTTTGTATCAAACAGCACAACCATTGTCTGTCACTTTCCATGCATAAAGTTTAGTGAGATGTTATATGTAAGATCTGATTTGCTAGTTCTTCCTTGTAGAGTTATAAATGGAAAGATTACACTATCTGATTAATAGTTTCTTCATACTCTGCATATAATTTGTGGCTGCAGAATATTGTAATTTGTTGCACACTATGTAACAAAACAACTGAAGATATGTTTAATAAATATTGTACTTATTGGAAGTAATATCAAACGTATGGTGATAAGTATTTTAATTCTATGGTTAAAGGGAAATAGAGCCTTTCATTATTCTTAAAACAGCCATTTCTGTGTGCAACCAGGGCATTGTAGACCTATCTTAGAGCAGCATTCAATATGTTTTCCAGATAATATATCCAATATATGACCTAGGGAGGCTTCTGTGCTGGGTAGGGATTTAACCAAGCTTAGTGGTTCAGGGAGATTAAACTGTATGAAAAGCAAGTTTAGGATGTATGCTTTCTAGCGCATTATCTTTGCTCCCTTCTCTGAAACCATTGGAAATGGTTTATTTGATCAACATTTTGTTAATTCTCTTCTGTGGTAGAGATAGAAAGCTGCACACCTTTCCTAATTGGCAAATGATCAGACTAACACATGTGCTAATTTTGTTTCTTCCATGCTGAGTCAGATGTTGACTATTTTATCCTCCACAATTATATAACAAGTTGGAGGAGAGTTAAAACATTAAAGTAGAAGGCAGGAAAAATTTACTATTTGATTGTCCTAATTTTAGAAATTATATCCTTAAAAATTAACTGAAAACACAAATGCTAGGTGGAAATGATGAGAGAAATATATTTATTTCAGTGGAATTTTGCACATGTGAAAATTTTGTTAAATAGGACCTTAAAAATCCTAGGGTTTGTTTTTATTGTGGGAAACAAAAATCTTTTGCTAACACTGGCATTTTAAGGTGATAGAAATCAAAGACTGTTTCCTTGGGATTGACGTAGCTACCAAAAACATTCTTAGAGGCTTGGGATGTGGCTGTTGGCAACACATTTTATGGTGGGGTCTTGAATTCAATGATAAAATTTAAATAAAACCAAGCCAAAAATTATAGGTTTCTTTATTTTCACTAAACAGGCAATTTAAATACATGGTACAAAAATAAGTCGTAAGATTATTGTAAAATGAAATGGACAGAATATTCAATTTAATTTTCCATCTATGAGAATTTCACAATAAAATCATAGTTTACTTTGTATTATAGATGTGCTTGTTGGATCTATTCATCCTCTCATAAGGCAACTGAAAAATTAAAGTTATCGAATAGTTATTTGGGTGAAGATTTTAAAAAATGCTTCAAAAGATCTGTTTTTTTGCCTTATAGTATAAAGGGGGAAAGACTTCAGAAACTATTTTCTAAAGTAGATAAATGATACAAATGTTAGATGTGATGCCACACACTTCAGTTTTATATAGCAAGTTGTTCACACTGTCAGCTTATTCTTGATGAGTTAGCATAAAACATGATGTGAATTTAAGATGTAAGTATATTTACATTACTTAGCTTTGAAAATGCTAGTGGTGTTCTCCCATTGCAGTAAAGACGGGCTTACCACAAGATGTTTCAGCATGCTCCACTATTT