Transcript asmbl_89755

Sequence
Transcript Sequence for observation asmbl_89755 of TGE0057093:
ATCTACCCAGCCCCCCAGGTCTCTACTGCAGTGGTGGAGCCCTACAACTCCATCCTGACCACCCACACCACACTGGAACATTCAGATTGTGCTTTCATGGTGGACAACGAAGCCATCTATGACATCTGCCGCAGGAACCTTGACATTGAGCGCCCTACCTATACCAACCTCAACCGCCTCATCAGTCAGATTGTGTCCTCAATCACTGCTTCTCTCCGCTTTGACGGGGCCCTCAATGTGGACCTCACTGAGTTCCAGACCAACCTGGTGCCCTACCCCCGCATCCACTTCCCGCTGGTCACCTACGCGCCCATCATCTCTGCCGAGAAAGCCTATCACGAACAGCTCTCTGTGGCCGAGATAACCAGCTCCTGCTTTGAGCCCAACAGCCAGATGGTGAAGTGCGACCCGAGACATGGCAAGTACATGGCCTGCTGCATGCTCTACCGGGGCGACGTGGTGCCCAAGGATGTGAATGTCGCTATTGCTGCCATCAAGACCAAGAGGACCATCCAGTTTGTAGACTGGTGTCCCACAGGCTTCAAGGTGGGCATCAACTACCAGCCCCCGACCGTGGTCCCCGGGGGAGACCTGGCCAAGGTGCAGCGGGCCGTCTGCATGCTCAGCAACACCACGGCCATTGCGGAGGCCTGGGCCCGCCTCGACCACAAGTTCGACCTCATGTACGCCAAGCGGGCCTTTGTGCATTGGTATGTGGGAGAGGGGATGGAAGAAGGAGAATTTTCTGAGGCCAGGGAAGACTTAGCTGCCCTGGAGAAGGATTATGAAGAAGTGGGGACTGATTCGTTTGAAGAAGAAAATGAAGGGGAGGAAT