Transcript asmbl_88183

Sequence
Transcript Sequence for observation asmbl_88183 of TGE0057092:
GCGTTTTACATGATCAGGTATTTATTGAGAAGTAAAATTTAGGAGGGTGTGGGACTGGTCTGAACTGATGCCAGACTGGTAGCTCAGGGGTACAGTGGAGAGTTGGAGAAGGGGTGACTGGGAGAGGAAGGACCCTCTGGGGAGATGACTCAGGGAGGCTGTGAGCCTCCTCCCTTGGGTGATTTTCACACTGGGTGCAGAATTCCCTGTACCCCACACTGAGAACCCCGGGGAGGCTAGCAATTTATGTGAGAAAAAAAATGAGATAAAACAAGATTTCTGGTTGTCAATGAGGATATTTATTGGGGTTTCATGAGTGCAGGGAGAAGGGCTGGATGACTTGGGATGGGGAGAGAGACCCCTCCCCTGGGATCCTGCAGCTCCAGGCTCCCGTGGGTGGGGTTAGAGTTGGGAACCTATGAACATTCTGTAGGGGCCACTGTCTTCTCCACGGTGCTCCCTTCATGCGTGACCTGGCAGCTGTAGCTTCTGTGGGACTTCCACTGCTCGGGCGTCAGGCTCAGGTAGCTGCTGGCCGCGTACTTGTTGTTGCTCTGTTTGGAGGGTTTGGTGGTCTCCACTCCCGCCTTGACGGGGCTGCCATCTGCCTTCCAGGCCACTGTCACAGCTCCCGGGTAGAAGTCACTGATCAGACACACTAGTGTGGCCTTGTTGGCTTGGAGCTCCTCAGAGGAGGGCGGGAACAGAGTGACAGTGGGGTTGGCCTTGGGCTGACC