Transcript asmbl_85782

Sequence
Transcript Sequence for observation asmbl_85782 of TGE0001566:
GTGCTCCTCGCTTCCTCCGCGGTCTTCCGAGCGGTCGCGTGAACTGCTTCCTGCAGGCTGGCCATGGCGCTTCACGTTCCCAAGGCTCCGGGCTTTGCCCAGATGCTCAAGGAGGGAGCGAAACACTTTTCAGGATTAGAAGAGGCTGTGTATAGAAACATACAAGCTTGCAAGGAGCTTGCCCAAACCACTCGTACAGCATATGGACCAAATGGAATGAACAAAATGGTTATCAACCACTTGGAGAAGTTGTTTGTGACAAACGATGCAGCAACTATTTTAAGAGAACTAGAAGTACAGCATCCTGCTGCAAAAATGATTGTAATGGCTTCTCATATGCAAGAGCAAGAAGTTGGAGATGGCACAAACTTTGTTCTGGTATTTGCTGGAGCTCTCCTGGAATTAGCTGAAGAACTTCTGAGGATTGGCCTGTCAGTTTCAGAGGTCATAGAAGGTTATGAAATAGCCTGCAGAAAAGCTCATGAGATTCTTCCTAATTTGGTATGTTGTTCTGCAAAAAACCTTCGAGATATTGATGAAGTCTCATCTCTACTTCGTACCTCCATAATGAGTAAACAATATGGTAATGAAGTATTTCTGGCCAAGCTTATTGCTCAGGCATGCGTATCTATTTTTCCTGATTCCGGCCATTTCAATGTTGATAACATCAGAGTTTGTAAAATTCTGGGCTCTGGTATCAGTTCCTCTTCAGTATTGCATGGCATGGTTTTTAAGAAGGAAACCGAAGGTGATGTAACATCTGTCAAAGATGCAAAAATAGCAGTGTACTCTTGTCCTTTTGATGGCATGATAACAGAAACTAAGGGAACAGTGTTGATAAAGACTGCTGAAGAATTGATGAATTTTAGTAAGGGAGAAGAAAACCTCATGGATGCACAAGTCAAAGCTATTGCTGATACTGGTGCAAATGTCGTAGTAACAGGTGGCAAAGTGGCAGACATGGCTCTTCATTATGCAAATAAATATAATATCATGTTAGTGAGGCTAAACTCAAAATGGGATCTCCGAAGACTTTGTAAAACTGTTGGTGCTACAGCTCTTCCTAGATTGACACCTCCTGTCCTTGAAGAAATGGGACACTGTGACAGTGTTTACCTCTCAGAAGTTGGAGATACTCAGGTGGTGGTTTTTAAGCATGAAAAGGAAGATGGCGCCATTTCTACCATAGTACTTCGAGGCTCTACAGACAATCTGATGGATGACATAGAAAGGGCAGTAGACGATGGTGTTAATACTTTCAAAGTTCTTACAAGGGATAAACGTCTTGTACCCGGAGGTGGAGCAACAGAAATTGAATTAGCCAAACAGATCACATCATATGGAGAGACATGTCCTGGACTTGAACAGTATGCTATTAAGAAGTTTGCTGAGGCATTTGAAGCTATTCCCCGCGCACTGGCAGAAAACTCTGGAGTTAAGGCCAATGAAGTAATCTCTAAACTTTATGCAGTACATCAAGAAGGAAATAAAAACGTTGGATTAGATATTGAGGCTGAAGTCCCTGCTGTAAAGGACATGCTGGAAGCTGGTATTCTAGATACTTACCTGGGAAAATATTGGGCTATCAAACTCGCTACTAATGCTGCAGTCACTGTACTTAGAGTGGATCAGATCATCATGGCAAAACCAGCTGGTGGGCCCAAGCCTCCAAGTGGGAAGAAAGACTGGGATGATGACCAAAATGATTGAAATTGGCTTAATTTTTACTGTAGGTGAAGGCTGTATTTGTAGTAGTACTCAAGAATCACCTGATGTTTTCTTATTCTCCTTAAATTAAGAGTTATTTTGTGTTTGTATTCTTGGCTGGATGTTATAATAAACATATTGTTACTGTCAAAGC