Transcript asmbl_85781

Sequence
Transcript Sequence for observation asmbl_85781 of TGE0056867:
TTCTATTTCACACATACAGTATTCTGCTGCTTCATAATATATGCACATATATCTTCATATTTTTTTGCCAAACCTTTATTTCTTCAGTCAACTATTATCTAATGACTTTGAACACCAACGTAGTGAAATGATTTTAAAGGGAATGTTTACTTGTTTTGCCAGGGAACAGTGTTGATAAAGACTGCTGAAGAATTGATGAATTTTAGTAAGGGAGAAGAAAACCTCATGGATGCACAAGTCAAAGCTATTGCTGATACTGGTGCAAATGTCGTAGTAACAGGTGGCAAAGTGGCAGACATGGCTCTTCATTATGCAAATAAATATAATATCATGTTAGTGAGGCTAAACTCAAAATGGGATCTCCGAAGACTTTGTAAAACTGTTGGTGCTACAGCTCTTCCTAGATTGACACCTCCTGTCCTTGAAGAAATGGGACACTGTGACAGTGTTTACCTCTCAGAAGTTGGAGATACTCAGGTGGTGGTTTTTAAGCATGAAAAGGAAGATGGCGCCATTTCTACCATAGTACTTCGAGGCTCTACAGACAATCTGATGGATGACATAGAAAGGGCAGTAGACGATGGTGTTAATACTTTCAAAGTTCTTACAAGGGATAAACGTCTTGTACCCGGAGGTGGAGCAACAGAAATTGAATTAGCCAAACAGATCACATCATATGGAGAGACATGTCCTGGACTTGAACAGTATGCTATTAAGAAGTTTGCTGAGGCATTTGAAGCTATTCCCCGCGCACTGGCAGAAAACTCTGGAGTTAAGGCCAATGAAGTAATCTCTAAACTTTATGCAGTACATCAAGAAGGAAATAAAAACGTTGGATTAGATATTGAGGCTGAAGTCCCTGCTGTAAAGGACATGCTGGAAGCTGGTATTCTAGATACTTACCTGGGAAAATATTGGGCTATCAAACTCGCTACTAATGCTGCAGTCACTGTACTTAGAGTGGATCAGATCATCATGGCAAAACCAGCTGGTGGGCCCAAGCCTCCAAGTGGGAAGAAAGACTGGGATGATGACCAAAATGATTGAAATTGGCTTAATTTTTACTGTAGGTGAAGGCTGTATTTGTAGTAGTACTCAAGAATCACCTGATGTTTTCTTATTCTCCTTAAATTAAGAGTTATTTTGTGTTTGTATTCTTGGCTGGATGTTATAATAAACATATTGTTACTGTCAAAGC