Transcript asmbl_85678

Sequence
Transcript Sequence for observation asmbl_85678 of TGE0056330:
CTCCTTGCCCTCCGCTCTCACTCTGGCTGGGAGCAGAAGGCAGCCTCGGTCTCTGGGCGGCGGCGGCGGCCCACTCTGCCCTGGCCGCGCTGTGTGGTGACCGCAGGCCCCAGACATGAGGGCGGCCCGTGCTCTGCTGCCCCTGCTGCTGCAGGCCTGCTGGACAGCCGCGCAGGATGAGCCGGAGACCCCGAGGGCCGTGGCCTTCCAGGACTGCCCCGTGGACCTGTTCTTTGTGCTGGACACCTCTGAGAGCGTGGCCCTGAGGCTGAAGCCCTACGGGGCCCTCGTGGACAAAGTCAAGTCCTTCACCAAGCGCTTCATCGACAACCTGAGGGACAGGTACTACCGCTGTGACCGAAACCTGGTGTGGAACGCAGGCGCGCTGCACTACAGTGACGAGGTGGAGATCATCCAAGGCCTCACGCGCATGCCTGGCGGCCGCGACGCACTCAAAAGCAGCGTGGACGCGGTCAAGTACTTTGGGAAGGGCACCTACACCGACTGCGCTATCAAGAAGGGGCTGGAGCAGCTCCTCGTGGGGGGCTCCCACCTGAAGGAGAATAAGTACCTGATTGTGGTGACCGACGGGCACCCCCTGGAGGGCTACAAGGAACCCTGTGGGGGGCTGGAGGATGCTGTGAACGAGGCCAAGCACCTGGGCGTCAAAGTCTTCTCGGTGGCCATCACACCCGACCACCTGGAGCCGCGTCTGAGCATCATCGCCACGGACCACACGTACCGGCGCAACTTCACGGCGGCTGACTGGGGCCAGAGCCGCGACGCAGAGGAGGCCATCAGCCAGACCATCGACACCATCGTGGACATGATCAAAAATAACGTGGAGCAAGTGTGCTGCTCCTTCGAATGCCAGCCTGCAAGAGGACCTCCGGGGCTCCGGGGCGACCCCGGCTTTGAGGGAGAACGAGGCAAGCCGGGGCTCCCAGGAGAGAAGGGAGAAGCCGGAGATCCTGGAAGACCCGGGGACCTCGGACCTGTTGGGTACCAGGGAATGAAGGGAGAAAAAGGGAGCCGTGGGGAGAAGGGCTCCAGGGGACCCAAGGGCTACAAGGGAGAGAAGGGCAAGCGTGGCATCGACGGGGTGGACGGCGTGAAGGGGGAGATGGGGTACCCAGGCCTGCCAGGCTGCAAGGGCTCGCCCGGGTTTGACGGCATTCAAGGACCCCCTGGCCCCAAGGGAGACCCCGGTGCCTTTGGACTGAAAGGAGAAAAGGGCGAGCCTGGAGCTGACGGGGAGGCGGGGAGACCAGGGAGCTCGGGACCATCTGGAGACGAGGGCCAGCCGGGAGAGCCTGGGCCCCCCGGAGAGAAAGGAGAGGCGGGCGACGAGGGGAACCCAGGACCTGACGGTGCCCCCGGGGAGCGGGGTGGCCCTGGAGAGAGAGGACCACGGGGGACCCCAGGCACGCGGGGACCAAGAGGAGACCCTGGTGAAGCTGGCCCGCAGGGTGATCAGGGAAGAGAAGGCCCCGTTGGTGTCCCTGGAGACCCGGGCGAGGCTGGCCCTATCGGACCTAAAGGCTACCGAGGCGATGAGGGTCCCCCAGGGTCCGAGGGTGCCAGAGGAGCCCCAGGACCTGCCGGACCCCCTGGAGACCCGGGGCTGATGGGTGAAAGGGGAGAAGACGGCCCCGCTGGAAATGGCACCGAGGGCTTCCCCGGCTTCCCCGGGTATCCGGGCAACAGGGGCGCTCCCGGGATAAACGGCACGAAGGGCTACCCCGGCCTCAAGGGGGACGAGGGAGAAGCCGGGGACCCCGGAGACGATAACAACGACATTGCACCCCGAGGAGTCAAAGGAGCAAAGGGGTACCGGGGTCCCGAGGGCCCCCAGGGACCCCCAGGACACCAAGGACCGCCTGGGCCGGACGAATGCGAGATTTTGGACATCATCATGAAAATGTGCTCTTGCTGTGGTGAGACCCAGGCTCTAGCTCCTGAGAGAATGGATCCCGGGGGTCGGGGAGCGAGGCCTGGGTCCCACACATGTCACAGGACAGCACATGGCACTCTGGTCCCCGCCCGCAGCTCCCTGCACCTGCCCGCCCCCTCTGGGGCCTGCTCCAAGCCAGCAGGGTTCCCGGGTGTTGGGCTGGGCCCCGCCCTCTTTCACCCATAACTGAAATAACCAGGAGCAGGCTTGGGGGGGTCCCTGCTCCATCATTCTGGCCCACAGGCCCCACCCTAGCCTGGCTGAGCAACGCCAGCCCTGACCAGCCGCCGGACAGAGCAGCCTTTACGGGGCCATGGGAGGGGGTGGGCTTTTCTGGGGCTGAGACGGGGGGACCCCAACGTGTCAGGTGAGGATGTGGCAGCCAAGGAGGGGCCAGGGCGGTGGAGGGGAGGGGCCAGGGCACTGGAGGGGAGG