Transcript asmbl_85185

Sequence
Transcript Sequence for observation asmbl_85185 of TGE0057089:
GTGGCGATCGGAGCGGAAGTGGAGCTACCGCCACCGCCGCCGCCGATTCCGGAGCCGGGGTAGTCGCCGCCGCCGCCGCCGCTGCAGCCACTGCAGGCACCGCTGCCGCCGCCTGAGTAGTGGGCTTAGGAAGGAAGAGGTCATCTCGCTCGGAGCTTCGCTCGGAAGGGTCTTTGTTCCCTGCAGCCCTCCCACGGGAATGACAATGGATAAAAGTGAGCTGGTACAGAAAGCCAAACTCGCTGAGCAGGCTGAGCGATATGATGATATGGCTGCAGCCATGAAGGCAGTCACAGAACAGGGGCATGAACTCTCCAACGAAGAGAGAAATCTGCTCTCTGTTGCCTACAAGAATGTGGTAGGCGCCCGCCGCTCTTCCTGGCGTGTCATCTCCAGCATTGAGCAGAAAACAGAGAGGAATGAGAAGAAGCAGCAGATGGGCAAAGAGTACCGTGAGAAGATAGAGGCAGAACTGCAGGACATCTGCAATGATGTTCTGGAGCTGTTGGACAAATATCTTATTCCCAATGCTACACAACCAGAAAGTAAGGTGTTCTACTTGAAAATGAAAGGAGATTATTTTAGGTATCTTTCTGAAGTGGCATCTGGAGACAACAAACAAACCACTGTGTCGAACTCCCAGCAGGCTTACCAGGAAGCATTTGAAATTAGTAAGAAAGAAATGCAGCCTACACACCCAATTCGTCTTGGTCTGGCACTAAATTTCTCAGTCTTTTACTATGAGATTCTAAACTCTCCTGAAAAGGCCTGTAGCCTGGCAAAAACGGCATTTGATGAAGCAATTGCTGAATTGGATACGCTGAATGAAGAGTCTTATAAAGACAGCACTCTGATCATGCAGTTACTTAGGGACAATCTCACTCTGTGGACATCGGAAAACCAGGGAGACGAAGGAGACGCTGGGGAGGGAGAGAACTAATGTTTCTCGTGCTTTGTGATCTGTTCAGTGTCACTCTGTACCCTCAACATATATCCCTTGTGCGAT