Transcript asmbl_84748

Sequence
Transcript Sequence for observation asmbl_84748 of TGE0057088:
CGCCCCACGGACAAGCCCCTGCGCCTGCCGCTGCAGGACGTGTACAAGATTGGCGGCATTGGCACGGTGCCCGTGGGCCGGGTGGAGACCGGCATCCTGCGGCCGGGCATGGTGGTGACCTTTGCGCCAGTGAACATCACCACTGAGGTGAAGTCAGTGGAGATGCACCACGAGGCTCTGAGCGAAGCTCTGCCCGGCGACAACGTCGGCTTCAATGTGAAGAACGTGTCGGTGAAGGACATCCGGCGGGGCAACGTGTGTGGGGACAGCAAGTCTGACCCGCCGCAGGAGGCTGCTCAGTTCACCTCCCAGGTCATCATCCTGAACCACCCGGGGCAGATTAGCGCCGGCTACTCCCCGGTCATCGACTGCCACACAGCCCACATCGCCTGCAAGTTTGCGGAGCTGAAGGAGAAGATTGACCGGCGCTCTGGCAAGAAGCTGGAGGACAACCC