Transcript asmbl_84723

Sequence
Transcript Sequence for observation asmbl_84723 of TGE0057081:
GCTTCAGACCCGCCGGGCTCCCGCCGCGCGCGCTGTCCCTGGAGCTCGGGGACGCGGCCCGGAGCCGGGAAGATGGCGAAGCGGCTCTGCGCGGGGAGCGCACTGTGTGTTCGCGGCCCCCGGGGCCCCGCGCCGCTGCTGCTGGTCGGGCTGGCGCTGCTGGGCGCGGCGCGGGCGCGGGAGGAGGCGGGCGGCGGCTTCAGCCTGCACCCGCCCTACTTCAACCTGGCCGAGGGCGCCCGCATCGCCGCCTCCGCGACCTGCGGAGAGGAGGCCCCGGCGCGCGGCTCCCCGCGCCCCACCGAGGACCTTTACTGCAAGCTGGTAGGGGGCCCCGTGGCCGGCGGCGACCCCAACCAGACCATCCGGGGCCAGTACTGTGACATCTGCACGGCTGCCAACAGCAACAAGGCACACCCCGCGAGCAATGCCATCGATGGCACGGAGCGCTGGTGGCAGAGTCCACCGCTGTCCCGCGGCCTGGAGTACAACGAGGTCAACGTCACCCTGGACCTGGGCCAGGTCTTCCACGTGGCCTACGTCCTCATCAAGTTTGCCAACTCACCCCGGCCGGACCTCTGGGTGCTGGAGCGGTCCATGGACTTCGGCCGCACCTACCAGCCCTGGCAGTTCTTTGCCTCCTCCAAGAGGGACTGTCTGGAGCGGTTCGGGCCACAGACGCTGGAGCGCATCACACGGGACGACGCGGCCATCTGCACCACCGAGTACTCACGCATCGTGCCCCTGGAGAACGGAGAGATCGTGGTGTCCCTGGTGAACGGACGTCCGGGCGCCATGAATTTCTCCTACTCGCCGCTGCTACGTGAGTTCACCAAGGCCACCAACGTCCGCCTGCGCTTCCTGCGTACCAACACGCTGCTGGGCCATCTCATGGGGAAGGCGCTGCGGGACCCCACGGTCACCCGCCGGTATTATTACAGCATCAAGGATATCAGCATCGGAGGCCGCTGTGTCTGCCACGGCCACGCGGATGCCTGCGATGCCAAAGACCCCACGGACCCGTTCAGGCTGCAGTGCACCTGCCAGCACAACACCTGCGGGGGCACCTGCGACCGCTGCTGCCCCGGCTTCAATCAGCAGCCGTGGAAGCCTGCGACTGCCAACAGTGCCAACGAGTGCCAGTCCTGTAACTGCTACGGCCATGCCACCGACTGTTACTACGACCCTGAGGTGGACCGGCGCCGCGCCAGCCAGAGCCTGGATGGCACCTATCAGGGTGGGGGTGTCTGTATCGACTGCCAGCACCACACCACCGGCGTCAACTGTGAGCGCTGCCTGCCCGGCTTCTACCGCTCTCCCAACCACCCTCTCGACTCGCCCCACGTCTGCCGCCGCTGCAACTGCGAGTCCGACTTCACGGATGGCACCTGCGAGGACCTGACGGGTCGATGCTACTGCCGGCCCAACTTCTCTGGGGAGCGGTGTGACGTGTGTGCCGAGGGCTTCACGGGCTTCCCAAGCTGCTACCCGACGCCCTCGTCCTCCAATGACACCAGGGAGCAGGTGCTGCCAGCCGGCCAGATTGTGAATTGTGACTGCAGCGCGGCAGGGACCCAGGGCAACGCCTGCCGGAAGGACCCAAGGGTGGGACGCTGTCTGTGCAAACCCAACTTCCAAGGCACCCATTGTGAGCTCTGCGCGCCAGGGTTCTACGGCCCCGGCTGCCAGCCCTGCCAGTGTTCCAGCCCTGGAGTGGCCGATGACCGCTGTGACCCTGACACAGGCCAGTGCAGGTGCCGAGTGGGCTTCGAGGGGGCCACATGTGATCGCTGTGCCCCCGGCTACTTTCACTTCCCTCTCTGCCAGTTGTGTGGCTGCAGCCCTGCAGGAACCTTGCCCGAGGGCTGCGATGAGGCCGGCCGCTGCCTATGCCAGCCTGAGTTTGCTGGACCTCATTGTGACCGGTGCCGCCCTGGCTACCATGGTTTCCCCAACTGCCAAGCATGCACCTGCGACCCTCGGGGAGCCCTGGACCAGCTCTGTGGGGCGGGAGGTTTGTGCCGCTGCCGCCCCGGCTACACAGGCACTGCCTGCCAGGAATGCAGCCCCGGCTTTCACGGCTTCCCCAGCTGTGTCCCCTGCCACTGCTCTGCTGAAGGCTCCCTGCACGCAGCCTGTGACCCCCGGAGTGGGCAGTGCAGCTGCCGGCCCCGTGTGACGGGGCTGCGGTGTGACACATGTGTGCCCGGTGCCTACAACTTCCCCTACTGCGAAGCTGGCTCTTGCCACCCTGCCGGTCTGGCCCCAGTGGATCCTGCCCTTCCTGAGGCACAGGTTCCCTGTATGTGCCGGGCTCACGTGGAGGGGCCGAGCTGTGACCGCTGCAAACCTGGGTTCTGGGGACTGAGCCCCAGCAACCCCGAGGGCTGTACCCGCTGCAGCTGCGACCTCAGGGGCACACTGGGTGGAGTTGCTGAGTGCCAGCCGGGCACCGGCCAGTGCTTCTGCAAGCCCCACGTGTGCGGCCAGGCCTGCGCGTCCTGCAAGGATGGCTTCTTTGGACTGGATCAGGCTGACTATTTTGGCTGCCGCAGCTGCCGGTGTGACATTGGCGGTGCACTGGGCCAGAGCTGTGAACCGAGGACGGGCGTCTGCCGGTGCCGCCCCAACACCCAGGGCCCCACCTGCAGCGAGCCTGCGAGGGACCACTACCTCCCGGACCTGCACCACCTGCGCCTGGAGCTGGAGGAGGCTGCCACACCTGAGGGTCACGCCGTGCGCTTTGGCTTCAACCCCCTCGAGTTCGAGAACTTCAGCTGGAGGGGCTACGCGCAGATGGCACCTGTCCAGCCCAGGATCGTGGCCAGGCTGAACCTGACCTCCCCTGACCTTTTCTGGCTCGTCTTCCGATACGTCAACCGGGGGGCCATGAGTGTGAGCGGGCGGGTCTCTGTGCGAGAGGAGGGCAGGTCGGCCACCTGCGCCAACTGCACAGCACAGAGTCAGCCCGTGGCCTTCCCACCCAGCACGGAGCCTGCCTTCATCACCGTGCCCCAGAGGGGCTTCGGAGAGCCCTTTGTGCTGAACCCTGGCACCTGGGCCCTGCGTGTGGAGGCCGAAGGGGTGCTCCTGGACTACGTGGTTCTGCTGCCTAGCGCATACTACGAGGCGGCGCTCCTGCAGCTGCGGGTGACTGAGGCCTGCACATACCGTCCCTCTGCCCAGCAGTCTGGCGACAACTGCCTCCTCTACACACACCTCCCCCTGGATGGCTTCCCCTCGGCCGCCGGGCTGGAGGCCCTGTGTCGCCAGGACAACAGCCTGCCCCGGCCCTGCCCCACGGAGCAGCTCAGCCCGTCGCACCCGCCACTGATCACCTGCACGGGCAGTGATGTGGACGTCCAGCTTCAAGTGGCAGTGCCACAGCCAGGCCGCTATGCCCTAGTGGTGGAGTACGCCAATGAGGATGCCCGCCAGGAGGTGGGCGTGGCCGTGCACACCCCACAGCGGGCCCCCCAGCAGGGGCTGCTCTCCCTGCACCCCTGCCTGTACAGCACCCTGTGCCGGGGCACTGCCCGGGATACCCAGGACCACCTGGCTGTCTTCCACCTGGACTCGGAGGCCAGCGTGAGGCTCACAGCCGAACAGGCACGCTTCTTCCTGCACGGGGTCACTCTGGTGCCCATTGAGGAGTTCAGCCCGGAGTTCGTGGAGCCCCGGGTCAGCTGCATCAGCAGCCACGGCGCCTTTGGCCCCAACAGTGCCGCCTGTCTGCCCTCGCGCTTCCCAAAGCCGCCCCAGCCCATCATCCTCAGGGACTGCCAGGTGATCCCGCTGCCGCCCGGCCTCCCGCTGACCCACGCGCAGGATCTCACTCCAGCCATGTCCCCAGCTGGACCCCGACCTCGGCCCCCCACCGCTGTGGACCCTGATGCAGAGCCCACCCTGCTGCGTGAGCCCCAGGCCACCGTGGTCTTCACCACCCATGTGCCCACGCTGGGCCGCTATGCCTTCCTGCTGCACGGCTACCAGCCAGCCCACCCCACCTTCCCCGTGGAAGTCCTCATCAACGCCGGCCGCGTGTGGCAGGGCCACGCCAACGCCAGCTTCTGTCCACATGGCTACGGCTGCCGCACCCTGGTGGTGTGTGAGGGCCAGGCCCTGCTGGACGTGACCCACAGCGAGCTCACTGTGACCGTGCGTGTGCCCAAGGGCCGGTGGCTCTGGCTGGATTATGTACTCGTGGTCCCTGAGAACGTCTACAGCTTTGGCTACCTCCGGGAGGAGCCCCTGGATAAATCCTATGACTTCATCAGCCACTGCGCAGCCCAGGGCTACCACATCAGCCCCAGCAGCTCATCCCTGTTCTGCCGAAACGCTGCTGCTTCCCTCTCCCTCTTCTATAACAACGGAGCCCGTCCATGTGGCTGCCACGAAGTAGGTGCTACAGGCCCCACGTGTGAGCCCTTCGGGGGCCAGTGTCCCTGCCATGCCCATGTCATTGGCCGTGACTGCTCCCGCTGTGCCACCGGATACTGGGGCTTCCCCAACTGCAGGCCCTGTGACTGCGGTGCCCGCCTCTGTGACGAGCTCACGGGCCAGTGCATCTGCCCGCCACGCACCATCCCGCCCGACTGCCTGCTGTGCCAGCCCCAGACCTTTGGCTGCCACCCCCTGGTCGGCTGTGAGGAGTGTAACTGCTCAGGGCCCGGCATCCAGGAGCTCACAGACCCTACCTGTGACACAGACAGCGGCCAGTGCAAGTGCAGACCCAACGTGACTGGGCGCCGCTGTGATACCTGCTCTCCGGGCTTCCATGGCTACCCCCGCTGCCGCCCCTGTGACTGTCACGAGGCGGGCACTGCGCCTGGCGTGTGTGACCCCCTCACAGGGCAGTGCTACTGTAAGGAGAACGTGCAGGGCCCCAAATGTGACCAGTGCAGCCTTGGGACCTTCTCACTGGATGCTGCCAACCCCAAAGGTTGCACCCGCTGCTTCTGCTTTGGGGCCACGGAGCGCTGCCGGAGCTCGTCCTACACCCGCCAGGAGTTCGTGGATATGGAGGGATGGGTGCTGCTGAGCACTGACCGGCAGGTGGTGCCCCACGAGCGGCAGCCAGGGACGGAGATGCTCCGTGCAGACCTGCGGCACGTGCCTGAGGCTGTGCCCGAGGCTTTCCCCGAGCTGTACTGGCAGGCCCCACCCTCCTACCTGGGGGACCGGGTGTCATCCTACGGTGGGACCCTCCGTTATGAACTGCACTCAGAGACCCAGCGGGGAGATGTCTTTGTCCCCATGGAGAGCAGGCCGGATGTGGTGCTGCAGGGCAACCAGATGAGCATCACATTCCTGGAGCCGGCATACCCCACGCCTGGCCACGTTCACCGTGGGCAGCTGCAGCTGGTGGAGGGGAACTTCCGGCATACGGAGACGCGCAACACTGTGTCCCGCGAGGAGCTCATGATGGTGCTGGCCAGCCTGGAGCAGCTGCAGATCCGTGCCCTCTTCTCACAGATCTCCTCGGCTGTCTTCCTGCGCAGGGTGGCACTGGAGGTGGCCAGCCCAGCAGGCCAGGGGGCCCTGGCCAGCAATGTGGAGCTGTGCCTGTGCCCCGCCAGCTACCGGGGGGACTCATGCCAGGAATGTGCCCCCGGCTTCTATCGGGACGTCAAAGGTCTCTTCCTGGGCCGATGTGTCCCTTGTCAGTGCCATGGACACTCAGACCGCTGCCTCCCTGGCTCTGGCGTCTGTGTGGACTGCCAGCACAACACCGAAGGGGCCCACTGTGAGCGCTGCCAGGCTGGCTTCGTGAGCAGCAGGGACGACCCCAGCGCCCCCTGTGTCAGCTGCCCCTGCCCCCTCTCAGTGCCTTCCAACAACTTCGCCGAGGGCTGTGTCCTGCGAGGCGGCCGCACCCAGTGCCTCTGCAAACCTGGTTATGCAGGTGCCTCCTGCGAGCGGTGTGCGCCCGGATTCTTTGGGAACCCACTGGTGCTGGGCAGCTCCTGCCAGCCATGCGACTGCAGCGGCAACGGTGACCCCAACTTGCTCTTCAGCGACTGCGACCCCCTGACGGGCGCCTGCCGTGGCTGCCTGCGCCACACCACTGGGCCCCGCTGCGAGATCTGTGCCCCCGGCTTCTACGGCAACGCCCTGCTGCCCGGCAACTGCACCCGGTGCGACTGTACCCCATGTGGGACAGAGGCCTGCGACCCCCACAGCGGGCACTGCCTGTGCAAGGCGGGCGTGACTGGGCGGCGCTGTGACCGCTGCCAGGAGGGACATTTTGGTTTCGATGGCTGCGGGGGCTGCCGCCCGTGTGCTTGTGGACCGGCCGCCGAGGGCTCCGAGTGCCACCCCCAGAGCGGACAGTGCCACTGCCGACCAGGGACCATGGGACCCCAGTGCCGCGAGTGTGCCCCTGGCTACTGGGGGCTCCCTGAGCAGGGCTGCAGGCGCTGCCAGTGCCCTGGGGGCCGCTGTGACCCTCACACGGGCCGCTGCAACTGCCCCCCGGGGCTCAGCGGGGAGCGCTGCGACACCTGCAGCCAGCAGCATCAGGTGCCTGTTCCAGGCGGGCCTGTGGGCCACAGCATCCACTGTGAAGTGTGTGACCACTGTGTGGTCCTGCTCCTGGATGACCTGGAACGGGCCGGCGCCCTCCTCCCCGCCATTCACGAGCAACTGCGTGGCATCAATGCCAGCTCCATGGCCTGGGCCCGTCTGCACAGGCTGAACGCCTCCATCGCTGACCTGCAGAGCCAGCTCCGGAGCCCCCTGGGCCCCCGCCATGAGACGGCACAGCAGCTGGAGGTGCTGGAGCAGCAGAGCACAAGCCTCGGGCAGGACGCACGGCGGCTAGGCGGCCAGGCCGTGGGGACCCGAGACCAGGCGAGCCAATTGCTGGCCGGCACCGAGGCCACACTGGGCCATGCGAAGACGCTGTTGGCGGCCATCCGGGCTGTGGACCGCACCCTGAGCGAGCTCATGTCCCAGACGGGCCACCTGGGGCTGGCCAATGCCTCGGCTCCATCAGGTGAGCAGCTGCTCCGGACACTGGCCGAGGTGGAGCGGCTGCTCTGGGAGATGCGGGCCCGGGACCTGGGGGCCCCGCAGGCAGCAGCTGAGGCTGAGTTGGCTGCAGCACAGAGATTGCTGGCCCGGGTGCAGGAGCAGCTGAGCAGCCTCTGGGAGGAGAACCAGGCACTGGCCACACAAACCCGCGACCGGCTGGCCCAGCACGAGGCCGGCCTCATGGACCTGCGAGAGGCTTTGAACCGGGCAGTGGACGCCACACGGGAGGCCCAGGAGCTCAACAGCCGCAACCAGGAGCGCCTGGAGGAAGCCCTGCAAAGGAAGCAGGAGCTGTCCCGGGACAATGCCACCCTGCAGGCCACTCTGCATGCGGCTAGGGACACCCTGGCCAGCGTCTTCAGATTGCTGCACAGCCTGGACCAGGCTAAGGAGGAGCTGGAGCGCCTCGCCGCCAGCCTGGATGGGGCTCGGACCCCACTGCTGCAGAGGATGCAGACCTTCTCCCCGGCGGGCAGCAAGCTGCGTCTAGTGGAGGCCGCCGAGGCCCACGCACAGCAGCTGGGCCAGCTGGCACTCAATCTGTCCAGCATCATCCTGGACGTCAACCAGGACCGCCTCACCCAGAGGGCCATCGAGGCCTCCAACGCCTACAGCCGCATCCTGCAGGCCGTGCAGGCTGCCGAGGATGCTGCTGGCCAGGCCCTGCAGCAGGCGGACCACACGTGGGCGACGGTGGTGCGGCAGGGCCTGGTGGACCGAGCCCAGCAGCTCCTGGCCAACAGCACTGCACTAGAAGAGGCCATGCTCCAGGAACAGCAGAGGCTGGGCCTTGTGTGGGCTGCCCTCCAGGGTGCCAGGACCCAGCTCCGAGATGTCCGGGCCAAGAAGGACCAGCTGGAGGCGCACATCCAGGCGGCGCAGGCCATGCTTGCCATGGACACAGACGAGACAAGCAAGAAGATCGCACATGCCAAGGCTGTGGCTGCTGAAGCCCAGGACACCGCCACCCGTGTGCAGTCCCAGCTGCAGGCCATGCAGGAGAATGTGGAGCGGTGGCAGGGCCAGTACGAGGGCCTGCGGGGCCAGGACCTGGGCCAGGCAGTGCTTGACGCAGGCCACTCAGTGTCCACCCTGGAGAAGACGCTGCCCCAGCTGCTGGCCAAGCTGAGCATCCTGGAGAACCGTGGGGTGCACAACGCCAGCCTGGCCCTGTCCGCCAGCATTGGCCGCGTGCGAGAGCTCATTGCCCAGGCCCGGGGGGCTGCCAGTAAGGTCAAGGTGCCCATGAAGTTCAACGGGCGCTCAGGGGTGCAGCTGCGCACCCCACGGGATCTTGCCGACCTTGCTGCCTACACTGCCCTCAAGTTCTACCTGCAGGGCCCAGAGCCTGAGCCTGGGCAGGGTACCGAGGATCGCTTTGTGATGTACATGGGCAGCCGCCAGGCCACTGGGGACTACATGGGTGTGTCTCTGCGTGACAAGAAGGTGCACTGGGTGTATCAGCTGGGTGAGGCGGGCCCTGCAGTCCTAAGCATCGATGAGGACATTGGGGAGCAGTTCGCAGCTGTCAGCCTGGACAGGACTCTCCAGTTTGGCCACATGTCCGTCACAGTGGAGAGACAGATGATCCAGGAAACCAAGGGTGACACGGTGGCCCCTGGGGCAGAGGGGCTGCTCAACCTGCGGCCAGACGACTTCGTCTTCTACGTCGGGGGGTACCCCAGTACCTTCACGCCCCCTCCCCTGCTTCGCTTCCCCGGCTACCGGGGCTGCATCGAGATGGACACGCTGAATGAGGAGGTGGTCAGCCTCTACAACTTCGAGAGGACCTTCCAGCTGGACACGGCTGTGGACAGGCCTTGTGCCCGCTCCAAGTCGACCGGGGACCCGTGGCTCACGGACGGCTCCTACCTGGACGGCACCGGCTTCGCCCGCATCAGCTTCGACAGTCAGATCAGCACCACCAAGCGCTTCGAGCAGGAGCTGCGGCTCGTGTCCTACAGCGGGGTGCTCTTCTTCCTGAAGCAGCAGAGCCAGTTCCTGTGCTTGGCCGTGCAAGAAGGCAGCCTCGTGCTGTTGTATGACTTTGGGGCTGGCCTGAAAAAGGCCGTCCCACTGCAGCCCCCACCGCCCCTGACCTCGGCCAGCAAGGCGATCCAGGTGTTCCTGCTGGGGGGCAGCCGCAAGCGTGTGCTGGTGCGTGTGGAGCGGGCCACGGTGTACAGCGTGGAGCAGGACAATGATCTGGAGCTGGCCGACGCCTACTACCTGGGGGGCGTGCCGCCCGACCAGCTGCCCCCGAGCCTGCGACGGCTCTTCCCCACCGGAGGCTCAGTCCGTGGCTGCGTCAAAGGCATCAAGGCCCTGGGCAAGTATGTGGACCTCAAGCGGCTGAACACGACAGGCGTGAGCGCCGGCTGCACCGCCGACCTGCTGGTGGGGCGCGCCATGACTTTCCATGGCCACGGCTTCCTTCGCCTGGCGCTCTCGAACGTGGCACCGCTCACTGGCAACGTCTACTCCGGCTTCGGCTTCCACAGCGCCCAGGACAGTGCCCTGCTCTACTACCGGGCGTCCCCGGATGGGCTATGCCAGGTGTCCCTGCAGCAGGGCCGTGTGAGCCTACAGCTCCTGAGGACTGAAGTGAAAACTCAAGCGGGCTTCGCCGATGGTGCCCCCCATTACGTCGCCTTCTACAGCAATGCCACGGGAGTCTGGCTGTATGTCGATGACCAGCTCCAGCAGATGAAGCCCCACCGGGGACCACCCCCCGAGCTCCAGCCGCAGCCTGAGGGGCCCCCGAGGCTCCTCCTGGGAGGCCTGCCTGAGTCTGGCACCATTTACAACTTCAGTGGCTGCATCAGCAACGTCTTCGTGCAGCGGCTCCTGGGCCCACAGCGCGTATTTGATCTGCAGCAGAACCTGGGCAGCGTCAATGTGAGCACGGGCTGTGCACCCGCCCTGCAAGCCCAGACCCCGGGCCTGGGGCCTAGAGGACTGCAGGCCACCGCCCGGAAGGTGGGCACCCCAGGGGCCTCCCGCCGCAGCCGTCAGCCCGCCCGGCATCCTGCCTGCATGCTGCCCCCACACCTCAGGACCACCCGAGACTCCTACCAGTTTGGGGGTTCCCTGTCCAGTCACCTGGAGTTTGTGGGCATCCTGGCCCGACATAGGAACTGGCCCAGTCTCTCCATGCACGTCCTCCCGCGAAGCTCCCGAGGCCTCCTCCTCTTCACTGCCCGTCTGAGGCCCGGCAGCCCCTCCCTGGCGCTCTTCCTGAGCAATGGCCACTTCGTTGCACAGATGGAAGGCCTCGGGACTCGGCTCCGCGCCCAGAGCCGCCAGCGCTCCCGGCCTGGCCGCTGGCACAAGGTCTCCGTGCGCTGGGAGAAGAACCGGATCCTGCTGGTGACGGACGGGGCCCGGGCCTGGAGCCAGGAGGGGCCGCACCGGCAGCACCAGGGGGCAGAGCACCCCCAGCCCCACACCCTCTTTGTGGGCGGCCTCCCGGCCAGCAGCCACAGCTCCAAACTTCCGGTGACCGTCGGGTTCAGCGGCTGTGTGAAGAGACTGAGGCTGCACGGGAGGCCCCTGGGGGCCCCCACACGGATGGCAGGGGTCACACCCTGCATCTTGGGCCCCCTGGAGGCGGGCCTGTTCTTCCCAGGCAGCGGGGGAGTTATCACTTTAGACCTCCCAGGAGCTACACTGCCTGATGTGGGCCTGGAACTGGAGGTGCGGCCCCTGGCAGTCACCGGACTGATCTTCCACTTGGGCCAGGCCCGGACGCCCCCCTACTTGCAGTTGCAGGTGACCGAGAAGCAAGTCCTGCTGCGGGCGGATGACGGAGCAGGGGAGTTCTCCACGTCAGTGACCCGCCCCTCAGTGCTGTGTGATGGCCAGTGGCACCGGCTAGCGGTGATGAAAAGCGGGAATGTGCTCCGGCTGGAGGTGGACGCGCAGAGCAACCACACCGTGGGCCCCTTGCTGGCGGCTGCAGCTGGTGCCCCAGCCCCTCTGTACCTCGGGGGCCTGCCTGAGCCCATGGCCGTGCAGCCCTGGCCCCCCGCCTACTGCGGCTGCATGAGGAGGCTGGCGGTGAACCGGTCCCCCGTCGCCATGACTCGCTCTGTGGAGGTCCACGGGGCAGTGGGGGCCAGTGGCTGCCCAGCCGCCTAGGACACAGCCAACCCCGGCCCCTGGTCAGGCCCCTGCAGCTGCCTCACACCGCCCCTTGTGCTCGCCTCATAGGTGTCTATTTGGACTCTAAGCTCTACGGGTGACAGATCTTGTTTCTGAAGATGGTTTAAGTTATAGCTTCTTAAACGAAAGAATAAAATACTGCAAAATGTTTTTATATTTGGCCCTTCCACCCATTTTTAATTGTGAGAGATTTGTCACCAATCATCACTGGTTCCTCCTTAAAAATTAAAAAGTAACTTCTGTGTAACCGAATGAATGTTGACTTAAAT