Transcript asmbl_84722

Sequence
Transcript Sequence for observation asmbl_84722 of TGE0057080:
GCTTCAGACCCGCCGGGCTCCCGCCGCGCGCGCTGTCCCTGGAGCTCGGGGACGCGGCCCGGAGCCGGGAAGATGGCGAAGCGGCTCTGCGCGGGGAGCGCACTGTGTGTTCGCGGCCCCCGGGGCCCCGCGCCGCTGCTGCTGGTCGGGCTGGCGCTGCTGGGCGCGGCGCGGGCGCGGGAGGAGGCGGGCGGCGGCTTCAGCCTGCACCCGCCCTACTTCAACCTGGCCGAGGGCGCCCGCATCGCCGCCTCCGCGACCTGCGGAGAGGAGGCCCCGGCGCGCGGCTCCCCGCGCCCCACCGAGGACCTTTACTGCAAGCTGGTAGGGGGCCCCGTGGCCGGCGGCGACCCCAACCAGACCATCCGGGGCCAGTACTGTGACATCTGCACGGCTGCCAACAGCAACAAGGCACACCCCGCGAGCAATGCCATCGATGGCACGGAGCGCTGGTGGCAGAGTCCACCGCTGTCCCGCGGCCTGGAGTACAACGAGGTCAACGTCACCCTGGACCTGGGCCAGGTCTTCCACGTGGCCTACGTCCTCATCAAGTTTGCCAACTCACCCCGGCCGGACCTCTGGGTGCTGGAGCGGTCCATGGACTTCGGCCGCACCTACCAGCCCTGGCAGTTCTTTGCCTCCTCCAAGAGGGACTGTCTGGAGCGGTTCGGGCCACAGACGCTGGAGCGCATCACACGGGACGACGCGGCCATCTGCACCACCGAGTACTCACGCATCGTGCCCCTGGAGAACGGAGAGATCGTGGTGTCCCTGGTGAACGGACGTCCGGGCGCCATGAATTTCTCCTACTCGCCGCTGCTACGTGAGTTCACCAAGGCCACCAACGTCCGCCTGCGCTTCCTGCGTACCAACACGCTGCTGGGCCATCTCATGGGGAAGGCGCTGCGGGACCCCACGGTCACCCGCCGGTATTATTACAGCATCAAGGATATCAGCATCGGAGGCCGCTGTGTCTGCCACGGCCACGCGGATGCCTGCGATGCCAAAGACCCCACGGACCCGTTCAGGCTGCAGTGCACCTGCCAGCACAACACCTGCGGGGGCACCTGCGACCGCTGCTGCCCCGGCTTCAATCAGCAGCCGTGGAAGCCTGCGACTGCCAACAGTGCCAACGAGTGCCAGTCCTGTAACTGCTACGGCCATGCCACCGACTGTTACTACGACCCTGAGGTGGACCGGCGCCGCGCCAGCCAGAGCCTGGATGGCACCTATCAGGGTGGGGGTGTCTGTATCGACTGCCAGCACCACACCACCGGCGTCAACTGTGAGCGCTGCCTGCCCGGCTTCTACCGCTCTCCCAACCACCCTCTCGACTCGCCCCACGTCTGCCGCCGCTGCAACTGCGAGTCCGACTTCACGGATGGCACCTGCGAGGACCTGACGGGTCGATGCTACTGCCGGCCCAACTTCTCTGGGGAGCGGTGTGACGTGTGTGCCGAGGGCTTCACGGGCTTCCCAAGCTGCTACCCGACGCCCTCGTCCTCCAATGACACCAGGGAGCAGGTGCTGCCAGCCGGCCAGATTGTGAATTGTGACTGCAGCGCGGCAGGGACCCAGGGCAACGCCTGCCGGAAGGACCCAAGGGTGGGACGCTGTCTGTGCAAACCCAACTTCCAAGGCACCCATTGTGAGCTCTGCGCGCCAGGGTTCTACGGCCCCGGCTGCCAGCCCTGCCAGTGTTCCAGCCCTGGAGTGGCCGATGACCGCTGTGACCCTGACACAGGCCAGTGCAGGTGCCGAGTGGGCTTCGAGGGGGCCACATGTGATCGCTGTGCCCCCGGCTACTTTCACTTCCCTCTCTGCCAGTTGTGTGGCTGCAGCCCTGCAGGAACCTTGCCCGAGGGCTGCGATGAGGCCGGCCGCTGCCTATGCCAGCCTGAGTTTGCTGGACCTCATTGTGACCGGTGCCGCCCTGGCTACCATGGTTTCCCCAACTGCCAAGCATGCACCTGCGACCCTCGGGGAGCCCTGGACCAGCTCTGTGGGGCGGGAGGTTTGTGCCGCTGCCGCCCCGGCTACACAGGCACTGCCTGCCAGGAATGCAGCCCCGGCTTTCACGGCTTCCCCAGCTGTGTCCCCTGCCACTGCTCTGCTGAAGGCTCCCTGCACGCAGCCTGTGACCCCCGGAGTGGGCAGTGCAGCTGCCGGCCCCGTGTGACGGGGCTGCGGTGTGACACATGTGTGCCCGGTGCCTACAACTTCCCCTACTGCGAAGCTGGCTCTTGCCACCCTGCCGGTCTGGCCCCAGTGGATCCTGCCCTTCCTGAGGCACAGGTTCCCTGTATGTGCCGGGCTCACGTGGAGGGGCCGAGCTGTGACCGCTGCAAACCTGGGTTCTGGGGACTGAGCCCCAGCAACCCCGAGGGCTGTACCCGCTGCAGCTGCGACCTCAGGGGCACACTGGGTGGAGTTGCTGAGTGCCAGCCGGGCACCGGCCAGTGCTTCTGCAAGCCCCACGTGTGCGGCCAGGCCTGCGCGTCCTGCAAGGATGGCTTCTTTGGACTGGATCAGGCTGACTATTTTGGCTGCCGCAGCTGCCGGTGTGACATTGGCGGTGCACTGGGCCAGAGCTGTGAACCGAGGACGGGCGTCTGCCGGTGCCGCCCCAACACCCAGGGCCCCACCTGCAGCGAGCCTGCGAGGGACCACTACCTCCCGGACCTGCACCACCTGCGCCTGGAGCTGGAGGAGGCTGCCACACCTGAGGGTCACGCCGTGCGCTTTGGCTTCAACCCCCTCGAGTTCGAGAACTTCAGCTGGAGGGGCTACGCGCAGATGGCACCTGTCCAGCCCAGGATCGTGGCCAGGCTGAACCTGACCTCCCCTGACCTTTTCTGGCTCGTCTTCCGATACGTCAACCGGGGGGCCATGAGTGTGAGCGGGCGGGTCTCTGTGCGAGAGGAGGGCAGGTCGGCCACCTGCGCCAACTGCACAGCACAGAGTCAGCCCGTGGCCTTCCCACCCAGCACGGAGCCTGCCTTCATCACCGTGCCCCAGAGGGGCTTCGGAGAGCCCTTTGTGCTGAACCCTGGCACCTGGGCCCTGCGTGTGGAGGCCGAAGGGGTGCTCCTGGACTACGTGGTTCTGCTGCCTAGCGCATACTACGAGGCGGCGCTCCTGCAGCTGCGGGTGACTGAGGCCTGCACATACCGTCCCTCTGCCCAGCAGTCTGGCGACAACTGCCTCCTCTACACACACCTCCCCCTGGATGGCTTCCCCTCGGCCGCCGGGCTGGAGGCCCTGTGTCGCCAGGACAACAGCCTGCCCCGGCCCTGCCCCACGGAGCAGCTCAGCCCGTCGCACCCGCCACTGATCACCTGCACGGGCAGTGATGTGGACGTCCAGCTTCAAGTGGCAGTGCCACAGCCAGGCCGCTATGCCCTAGTGGTGGAGTACGCCAATGAGGATGCCCGCCAGGAGGTGGGCGTGGCCGTGCACACCCCACAGCGGGCCCCCCAGCAGGGGCTGCTCTCCCTGCACCCCTGCCTGTACAGCACCCTGTGCCGGGGCACTGCCCGGGATACCCAGGACCACCTGGCTGTCTTCCACCTGGACTCGGAGGCCAGCGTGAGGCTCACAGCCGAACAGGCACGCTTCTTCCTGCACGGGGTCACTCTGGTGCCCATTGAGGAGTTCAGCCCGGAGTTCGTGGAGCCCCGGGTCAGCTGCATCAGCAGCCACGGCGCCTTTGGCCCCAACAGTGCCGCCTGTCTGCCCTCGCGCTTCCCAAAGCCGCCCCAGCCCATCATCCTCAGGGACTGCCAGGTGATCCCGCTGCCGCCCGGCCTCCCGCTGACCCACGCGCAGGATCTCACTCCAGCCATGTCCCCAGCTGGACCCCGACCTCGGCCCCCCACCGCTGTGGACCCTGATGCAGAGCCCACCCTGCTGCGTGAGCCCCAGGCCACCGTGGTCTTCACCACCCATGTGCCCACGCTGGGCCGCTATGCCTTCCTGCTGCACGGCTACCAGCCAGCCCACCCCACCTTCCCCGTGGAAGTCCTCATCAACGCCGGCCGCGTGTGGCAGGGCCACGCCAACGCCAGCTTCTGTCCACATGGCTACGGCTGCCGCACCCTGGTGGTGTGTGAGGGCCAGGCCCTGCTGGACGTGACCCACAGCGAGCTCACTGTGACCGTGCGTGTGCCCAAGGGCCGGTGGCTCTGGCTGGATTATGTACTCGTGGTCCCTGAGAACGTCTACAGCTTTGGCTACCTCCGGGAGGAGCCCCTGGATAAATCCTATGACTTCATCAGCCACTGCGCAGCCCAGGGCTACCACATCAGCCCCAGCAGCTCATCCCTGTTCTGCCGAAACGCTGCTGCTTCCCTCTCCCTCTTCTATAACAACGGAGCCCGTCCATGTGGCTGCCACGAAGTAGGTGCTACAGGCCCCACGTGTGAGCCCTTCGGGGGCCAGTGTCCCTGCCATGCCCATGTCATTGGCCGTGACTGCTCCCGCTGTGCCACCGGATACTGGGGCTTCCCCAACTGCAGGCCCTGTGACTGCGGTGCCCGCCTCTGTGACGAGCTCACGGGCCAGTGCATCTGCCCGCCACGCACCATCCCGCCCGACTGCCTGCTGTGCCAGCCCCAGACCTTTGGCTGCCACCCCCTGGTCGGCTGTGAGGAGTGTAACTGCTCAGGGCCCGGCATCCAGGAGCTCACAGACCCTACCTGTGACACAGACAGCGGCCAGTGCAAGTGCAGACCCAACGTGACTGGGCGCCGCTGTGATACCTGCTCTCCGGGCTTCCATGGCTACCCCCGCTGCCGCCCCTGTGACTGTCACGAGGCGGGCACTGCGCCTGGCGTGTGTGACCCCCTCACAGGGCAGTGCTACTGTAAGGAGAACGTGCAGGGCCCCAAATGTGACCAGTGCAGCCTTGGGACCTTCTCACTGGATGCTGCCAACCCCAAAGGTTGCACCCGCTGCTTCTGCTTTGGGGCCACGGAGCGCTGCCGGAGCTCGTCCTACACCCGCCAGGAGTTCGTGGATATGGAGGGATGGGTGCTGCTGAGCACTGACCGGCAGGTGGTGCCCCACGAGCGGCAGCCAGGGACGGAGATGCTCCGTGCAGACCTGCGGCACGTGCCTGAGGCTGTGCCCGAGGCTTTCCCCGAGCTGTACTGGCAGGCCCCACCCTCCTACCTGGGGGACCGGGTGTCATCCTACGGTGGGACCCTCCGTTATGAACTGCACTCAGAGACCCAGCGGGGAGATGTCTTTGTCCCCATGGAGAGCAGGCCGGATGTGGTGCTGCAGGGCAACCAGATGAGCATCACATTCCTGGAGCCGGCATACCCCACGCCTGGCCACGTTCACCGTGGGCAGCTGCAGCTGGTGGAGGGGAACTTCCGGCATACGGAGACGCGCAACACTGTGTCCCGCGAGGAGCTCATGATGGTGCTGGCCAGCCTGGAGCAGCTGCAGATCCGTGCCCTCTTCTCACAGATCTCCTCGGCTGTCTTCCTGCGCAGGGTGGCACTGGAGGTGGCCAGCCCAGCAGGCCAGGGGGCCCTGGCCAGCAATGTGGAGCTGTGCCTGTGCCCCGCCAGCTACCGGGGGGACTCATGCCAGGAATGTGCCCCCGGCTTCTATCGGGACGTCAAAGGTCTCTTCCTGGGCCGATGTGTCCCTTGTCAGTGCCATGGACACTCAGACCGCTGCCTCCCTGGCTCTGGCGTCTGTGTGGACTGCCAGCACAACACCGAAGGGGCCCACTGTGAGCGCTGCCAGGCTGGCTTCGTGAGCAGCAGGGACGACCCCAGCGCCCCCTGTGTCAGCTGCCCCTGCCCCCTCTCAGTGCCTTCCAACAACTTCGCCGAGGGCTGTGTCCTGCGAGGCGGCCGCACCCAGTGCCTCTGCAAACCTGGTTATGCAGGTGCCTCCTGCGAGCGGTGTGCGCCCGGATTCTTTGGGAACCCACTGGTGCTGGGCAGCTCCTGCCAGCCATGCGACTGCAGCGGCAACGGTGACCCCAACTTGCTCTTCAGCGACTGCGACCCCCTGACGGGCGCCTGCCGTGGCTGCCTGCGCCACACCACTGGGCCCCGCTGCGAGATCTGTGCCCCCGGCTTCTACGGCAACGCCCTGCTGCCCGGCAACTGCACCCGGTGCGACTGTACCCCATGTGGGACAGAGGCCTGCGACCCCCACAGCGGGCACTGCCTGTGCAAGGCGGGCGTGACTGGGCGGCGCTGTGACCGCTGCCAGGAGGGACATTTTGGTTTCGATGGCTGCGGGGGCTGCCGCCCGTGTGCTTGTGGACCGGCCGCCGAGGGCTCCGAGTGCCACCCCCAGAGCGGACAGTGCCACTGCCGACCAGGGACCATGGGACCCCAGTGCCGCGAGTGTGCCCCTGGCTACTGGGGGCTCCCTGAGCAGGGCTGCAGGCGCTGCCAGTGCCCTGGGGGCCGCTGTGACCCTCACACGGGCCGCTGCAACTGCCCCCCGGGGCTCAGCGGGGAGCGCTGCGACACCTGCAGCCAGCAGCATCAGGTGCCTGTTCCAGGCGGGCCTGTGGGCCACAGCATCCACTGTGAAGTGTGTGACCACTGTGTGGTCCTGCTCCTGGATGACCTGGAACGGGCCGGCGCCCTCCTCCCCGCCATTCACGAGCAACTGCGTGGCATCAATGCCAGCTCCATGGCCTGGGCCCGTCTGCACAGGCTGAACGCCTCCATCGCTGACCTGCAGAGCCAGCTCCGGAGCCCCCTGGGCCCCCGCCATGAGACGGCACAGCAGCTGGAGGTGCTGGAGCAGCAGAGCACAAGCCTCGGGCAGGACGCACGGCGGCTAGGCGGCCAGGCCGTGGGGACCCGAGACCAGGCGAGCCAATTGCTGGCCGGCACCGAGGCCACACTGGGCCATGCGAAGACGCTGTTGGCGGCCATCCGGGCTGTGGACCGCACCCTGAGCGAGCTCATGTCCCAGACGGGCCACCTGGGGCTGGCCAATGCCTCGGCTCCATCAGGTGAGCAGCTGCTCCGGACACTGGCCGAGGTGGAGCGGCTGCTCTGGGAGATGCGGGCCCGGGACCTGGGGGCCCCGCAGGCAGCAGCTGAGGCTGAGTTGGCTGCAGCACAGAGATTGCTGGCCCGGGTGCAGGAGCAGCTGAGCAGCCTCTGGGAGGAGAACCAGGCACTGGCCACACAAACCCGCGACCGGCTGGCCCAGCACGAGGCCGGCCTCATGGACCTGCGAGAGGCTTTGAACCGGGCAGTGGACGCCACACGGGAGGCCCAGGAGCTCAACAGCCGCAACCAGGAGCGCCTGGAGGAAGCCCTGCAAAGGAAGCAGGAGCTGTCCCGGGACAATGCCACCCTGCAGGCCACTCTGCATGCGGCTAGGGACACCCTGGCCAGCGTCTTCAGATTGCTGCACAGCCTGGACCAGGCTAAGGAGGAGCTGGAGCGCCTCGCCGCCAGCCTGGATGGGGCTCGGACCCCACTGCTGCAGAGGATGCAGACCTTCTCCCCGGCGGGCAGCAAGCTGCGTCTAGTGGAGGCCGCCGAGGCCCACGCACAGCAGCTGGGCCAGCTGGCACTCAATCTGTCCAGCATCATCCTGGACGTCAACCAGGACCGCCTCACCCAGAGGGCCATCGAGGCCTCCAACGCCTACAGCCGCATCCTGCAGGCCGTGCAGGCTGCCGAGGATGCTGCTGGCCAGGCCCTGCAGCAGGCGGACCACACGTGGGCGACGGTGGTGCGGCAGGGCCTGGTGGACCGAGCCCAGCAGCTCCTGGCCAACAGCACTGCACTAGAAGAGGCCATGCTCCAGGAACAGCAGAGGCTGGGCCTTGTGTGGGCTGCCCTCCAGGGTGCCAGGACCCAGCTCCGAGATGTCCGGGCCAAGAAGGACCAGCTGGAGGCGCACATCCAGGCGGCGCAGGCCATGCTTGCCATGGACACAGACGAGACAAGCAAGAAGATCGCACATGCCAAGGCTGTGGCTGCTGAAGCCCAGGACACCGCCACCCGTGTGCAGTCCCAGCTGCAGGCCATGCAGGAGAATGTGGAGCGGTGGCAGGGCCAGTACGAGGGCCTGCGGGGCCAGGACCTGGGCCAGGCAGTGCTTGACGCAGGCCACTCAGTGTCCACCCTGGAGAAGACGCTGCCCCAGCTGCTGGCCAAGCTGAGCATCCTGGAGAACCGTGGGGTGCACAACGCCAGCCTGGCCCTGTCCGCCAGCATTGGCCGCGTGCGAGAGCTCATTGCCCAGGCCCGGGGGGCTGCCAGTAAGGTCAAGGTGCCCATGAAGTTCAACGGGCGCTCAGGGGTGCAGCTGCGCACCCCACGGGATCTTGCCGACCTTGCTGCCTACACTGCCCTCAAGTTCTACCTGCAGGGCCCAGAGCCTGAGCCTGGGCAGGGTACCGAGGATCGCTTTGTGATGTACATGGGCAGCCGCCAGGCCACTGGGGACTACATGGGTGTGTCTCTGCGTGACAAGAAGGTGCACTGGGTGTATCAGCTGGGTGAGGCGGGCCCTGCAGTCCTAAGCATCGATGAGGACATTGGGGAGCAGTTCGCAGCTGTCAGCCTGGACAGGACTCTCCAGTTTGGCCACATGTCCGTCACAGTGGAGAGACAGATGATCCAGGAAACCAAGGGTGACACGGTGGCCCCTGGGGCAGAGGGGCTGCTCAACCTGCGGCCAGACGACTTCGTCTTCTACGTCGGGGGGTACCCCAGTACCTTCACGCCCCCTCCCCTGCTTCGCTTCCCCGGCTACCGGGGCTGCATCGAGATGGACACGCTGAATGAGGAGGTGGTCAGCCTCTACAACTTCGAGAGGACCTTCCAGCTGGACACGGCTGTGGACAGGCCTTGTGCCCGCTCCAAGTCGACCGGGGACCCGTGGCTCACGGACGGCTCCTACCTGGACGGCACCGGCTTCGCCCGCATCAGCTTCGACAGTCAGATCAGCACCACCAAGCGCTTCGAGCAGGAGCTGCGGCTCGTGTCCTACAGCGGGGTGCTCTTCTTCCTGAAGCAGCAGAGCCAGTTCCTGTGCTTGGCCGTGCAAGAAGGCAGCCTCGTGCTGTTGTATGACTTTGGGGCTGGCCTGAAAAAGGCCGTCCCACTGCAGCCCCCACCGCCCCTGACCTCGGCCAGCAAGGCGATCCAGGTGTTCCTGCTGGGGGGCAGCCGCAAGCGTGTGCTGGTGCGTGTGGAGCGGGCCACGGTGTACAGCGTGGAGCAGGACAATGATCTGGAGCTGGCCGACGCCTACTACCTGGGGGGCGTGCCGCCCGACCAGCTGCCCCCGAGCCTGCGACGGCTCTTCCCCACCGGAGGCTCAGTCCGTGGCTGCGTCAAAGGCATCAAGGCCCTGGGCAAGTATGTGGACCTCAAGCGGCTGAACACGACAGGCGTGAGCGCCGGCTGCACCGCCGACCTGCTGGTGGGGCGCGCCATGACTTTCCATGGCCACGGCTTCCTTCGCCTGGCGCTCTCGAACGTGGCACCGCTCACTGGCAACGTCTACTCCGGCTTCGGCTTCCACAGCGCCCAGGACAGTGCCCTGCTCTACTACCGGGCGTCCCCGGATGGGCTATGCCAGGTGTCCCTGCAGCAGGGCCGTGTGAGCCTACAGCTCCTGAGGACTGAAGTGAAAACTCAAGCGGGCTTCGCCGATGGTGCCCCCCATTACGTCGCCTTCTACAGCAATGCCACGGGAGTCTGGCTGTATGTCGATGACCAGCTCCAGCAGATGAAGCCCCACCGGGGACCACCCCCCGAGCTCCAGCCGCAGCCTGAGGGGCCCCCGAGGCTCCTCCTGGGAGGCCTGCCTGAGTCTGGCACCATTTACAACTTCAGTGGCTGCATCAGCAACGTCTTCGTGCAGCGGCTCCTGGGCCCACAGCGCGTATTTGATCTGCAGCAGAACCTGGGCAGCGTCAATGTGAGCACGGGCTGTGCACCCGCCCTGCAAGCCCAGACCCCGGGCCTGGGGCCTAGAGGACTGCAGGCCACCGCCCGGAAGGCCTCCCGCCGCAGCCGTCAGCCCGCCCGGCATCCTGCCTGCATGCTGCCCCCACACCTCAGGACCACCCGAGACTCCTACCAGTTTGGGGGTTCCCTGTCCAGTCACCTGGAGTTTGTGGGCATCCTGGCCCGACATAGGAACTGGCCCAGTCTCTCCATGCACGTCCTCCCGCGAAGCTCCCGAGGCCTCCTCCTCTTCACTGCCCGTCTGAGGCCCGGCAGCCCCTCCCTGGCGCTCTTCCTGAGCAATGGCCACTTCGTTGCACAGATGGAAGGCCTCGGGACTCGGCTCCGCGCCCAGAGCCGCCAGCGCTCCCGGCCTGGCCGCTGGCACAAGGTCTCCGTGCGCTGGGAGAAGAACCGGATCCTGCTGGTGACGGACGGGGCCCGGGCCTGGAGCCAGGAGGGGCCGCACCGGCAGCACCAGGGGGCAGAGCACCCCCAGCCCCACACCCTCTTTGTGGGCGGCCTCCCGGCCAGCAGCCACAGCTCCAAACTTCCGGTGACCGTCGGGTTCAGCGGCTGTGTGAAGAGACTGAGGCTGCACGGGAGGCCCCTGGGGGCCCCCACACGGATGGCAGGGGTCACACCCTGCATCTTGGGCCCCCTGGAGGCGGGCCTGTTCTTCCCAGGCAGCGGGGGAGTTATCACTTTAGGTCTGTGGGTGCTGGCATCCCAGGCCTCAGCAGGGCAGGGCAGGGGGCTCCAGGAGGTTCTGGGGAGGGGCCCCCCCTTTCTTCTCCATCACAACCCCTCCCCGCAGACCTCCCAGGAGCTACACTGC