Transcript asmbl_74476

Sequence
Transcript Sequence for observation asmbl_74476 of TGE0056612:
CCTGACTGGTATCCCTGGCCCCAGTCCAGTTTGGAGCTCAGTCTTCCACCAAAGGCCGTTCAGTTCTCCTGGGCTCCAGCCTCCTGCAAGGACTGCAAGAGTTTTCCTCCGCAGCTCTGAGTCTCCACTTTTTTGGTGGAGAAAGGCTGCAAAAAGAAAAAGAGACGCAGTGAGTGGGAAAAGTATGCATCCTATTCAAACCTAATTGAATCGAGGAGCCCAGGGACACACGCCTTCAGGTTTGCTCAGGGGTTCATATTTGGTGCTTAGACAAATTCAAAATGAGGAAACATCGGCACTTGCCCTTAGTGGCCGTCTTTTGCCTCTTTCTCTCAGGCTTTCCTACAACTCATGCCCAGCAGCAGCAAGCAGTCATTGAAGTCAACAAGAGAGACATAGTCTTCCTGGTGGATGGCTCATCTGCACTGGGACTGGCCAACTTCAATGCCATCCGAGACTTCATTGCTAAAGTCATCCAGAGGCTGGAAATCGGACAGGATCTTATCCAGGTGGCAGTGGCCCAGTATGCAGACACTGTGAGGCCTGAATTTTATTTCAATACCCATCCAACAAAAAGGGAAGTCATAACCGCTGTGCGGAAAATGAAGCCCCTGGACGGCTCGGCCCTGTACACGGGCTCTGCTCTAGACTTTGTTCGTAACAACCTATTCACGAGTTCAGCCGGCTACCGGGCTGCCGAGGGGATTCCTAAGCTTTTGGTGCTGATCACAGGTGGTAAGTCCCTAGATGAAATCAGCCAGCCTGCCCAGGAGCTGAAGAGAAGCAGCATAATGGCCTTTGCCATTGGGAACAAGGGTGCCGATCAGGCTGAGCTGGAAGAGATCGCTTTCGACTCCTCCCTGGTGTTCATCCCAGCTGAGTTCCGAGCCGCCCCATTGCAAGGCATGCTGCCTGGCTTGCTGGCACCTCTCAGGACCCTCTCTGGAACCCCTGAAGTTCACTCAAACAAAAGGGATATCATCTTTCTTTTGGATGGATCAGCCAACGTTGGAAAAACCAATTTCCCTTATGTGCGCGACTTTGTAATGAACCTAGTTAACAGCCTTGATATTGGAAATGACAATATTCGTGTTGGTTTAGTGCAATTTAGTGACACTCCTGTAACGGAGTTCTCTTTAAACACATACCAGACCAAGTCAGATATCCTTGGTCATCTGAGGCAGCTGCAGCTCCAGGGAGGTTCGGGCCTGAACACAGGCTCAGCCCTAAGCTATGTCTATGCCAACCACTTCACGGAAGCTGGCGGCAGCAGGATCCGTGAACACGTGCCGCAGCTCCTGCTTCTGCTCACAGCTGGGCAGTCTGAGGACTCCTATTTGCAAGCTGCCAACGCCTTGACACGCGCGGGCATCCTGACTTTTTGTGTGGGAGCTAGCCAGGCGAATAAGGCAGAGCTTGAGCAGATTGCTTTTAACCCAAGCCTGGTGTATCTCATGGATGATTTCAGCTCCCTGCCAGCTTTGCCTCAGCAGCTGATTCAGCCCCTAACCACATATGTTAGTGGAGGTGTGGAGGAAGTACCACTCGCTCAGCCAGAGAGCAAGCGAGACATTCTGTTCCTCTTTGACGGCTCAGCCAATCTTGTGGGCCAGTTCCCTGTTGTCCGTGACTTTCTCTACAAGATTATCGATGAGCTCAATGTGAAGCCAGAGGGGACCCGAATTGCGGTGGCTCAGTACAGCGATGATGTCAAGGTGGAGTCCCGTTTTGATGAGCACCAGAGTAAGCCTGAGATCCTGAATCTTGTGAAGAGAATGAAGATCAAGACGGGCAAAGCCCTCAACCTGGGCTACGCGCTGGACTATGCACAGAGGTACATTTTTGTGAAGTCTGCTGGCAGCCGGATCGAGGATGGAGTGCTTCAGTTCCTGGTGCTGCTGGTCGCAGGAAGGTCATCTGACCGTGTGGATGGGCCAGCAAGTAACCTGAAGCAGAGTGGGGTTGTGCCTTTCATCTTCCAAGCCAAGAACGCAGACCCTGCTGAGTTAGAGCAGATCGTGCTGTCTCCAGCGTTTATCCTGGCTGCAGAGTCGCTTCCCAAGATTGGAGATCTTCATCCACAGATAGTGAATCTCTTAAAATCAGTGCACAACGGAGCACCAGCACCAGTTTCAGGTGAAAAGGACGTGGTGTTTCTGCTTGATGGCTCTGAGGGCGTCAGGAGCGGCTTCCCTCTGTTGAAAGAGTTTGTCCAGAGAGTGGTGGAAAGCCTGGATGTGGGCCAGGACCGGGTCCGCGTGGCCGTGGTGCAGTACAGCGACCGGACCAGGCCCGAGTTCTACCTGAATTCATACATGAACAAGCAGGACGTCGTCAACGCTGTCCGCCAGCTGACCCTGCTGGGAGGGCCGACCCCCAACACCGGGGCCGCCCTGGAGTTTGTCCTGAGGAACATCCTGGTCAGCTCTGCGGGAAGCAGGATAACAGAAGGTGTGCCCCAGCTGCTGATCGTCCTCACGGCCGACAGGTCTGGGGATGATGTGCGGAACCCCTCCGTGGTCGTGAAGAGGGGTGGGGCTGTGCCCATTGGCATTGGCATCGGGAACGCTGACATCACAGAGATGCAGACCATCTCCTTCATCCCGGACTTTGCCGTGGCCATTCCCACCTTTCGCCAGCTGGGGACCGTCCAACAGGTCATCTCTGAGAGGGTGACCCAGCTCACCCGCGAGGAGCTGAGCAGGCTGCAGCCGGTGTTGCAGCCTCTACCGAGCCCAGGTGTTGGTGGCAAGAGGGACGTGGTCTTTCTCATCGATGGGTCCCAAAGTGCCGGGCCTGAGTTCCAGTACGTTCGCACCCTCATAGAGAGGCTGGTTGACTACCTGGACGTGGGCTTTGACACCACCCGGGTGGCTGTCATCCAGTTCAGCGATGACCCCAAGGTGGAGTTCCTGCTGAACGCCCATTCCAGCAAGGATGAAGTGCAGAACGCGGTGCAGCGGCTGAGGCCCAAGGGAGGGCGGCAGATCAACGTGGGCAATGCCCTGGAGTACGTGTCCAGGAACATCTTCAAGAGGCCCCTGGGGAGCCGCATTGAAGAGGGCGTCCCGCAGTTCCTGGTCCTCATCTCGTCTGGAAAGTCTGACGATGAGGTGGACGACCCGGCGGTGGAGCTCAAGCAGTTTGGCGTGGCCCCTTTCACGATCGCCAGGAACGCAGACCAGGAGGAGCTGGTGAAGATCTCGCTGAGCCCCGAATATGTGTTCTCGGTGAGCACCTTCCGGGAGCTGCCCAGCCTGGAGCAGAAACTGCTGACGCCCATCACGACCCTGACCTCAGAGCAGATCCAGAAGCTCTTAGCCAGCACTCGCTATCCACCTCCAGCAGTTGAGAGTGATGCTGCAGACATTGTCTTTCTGATCGACAGCTCTGAGGGAGTTAGGCCAGATGGCTTTGCACATATTCGAGATTTTGTTAGCAGGATTGTTCGAAGACTCAACATCGGCCCCAGTAAAGTGAGAGTTGGGGTCGTGCAGTTCAGCAATGATGTCTTCCCAGAATTCTATCTGAAAACCTACAGATCCCAGGCCCCGGTGCTGGACGCCATACGGCGCCTGAGGCTCAGAGGGGGGTCCCCACTGAACACTGGCAAGGCTCTCGAATTTGTGGCAAGAAACCTCTTTGTTAAGTCTGCGGGGAGTCGCATAGAAGACGGGGTGCCCCAACACCTGGTCCTGGTCCTGGGTGGAAAATCCCAGGACGATGTGTCCAGGTTCGCCCAGGTGATCCGTTCCTCGGGCATTGTGAGTTTAGGGGTAGGAGACCGGAACATCGACAGAACAGAGCTGCAGACCATCACCAATGACCCCAGACTGGTCTTCACAGTGCGAGAGTTCAGAGAGCTTCCCAACATAGAAGAAAGAATCATGAACTCGTTTGGACCCTCCGCAGCCACTCCTGCACCTCCAGGGGTGGACACCCCTCCTCCTTCACGGCCAGAGAAGAAGAAAGCAGACATTGTGTTCCTGTTGGATGGTTCCATCAACTTCAGGAGGGACAGTTTCCAGGAAGTGCTTCGTTTTGTGTCTGAAATAGTGGACACAGTTTATGAAGATGGCGACTCCATCCAAGTGGGGCTTGTCCAGTACAACTCTGACCCCACTGACGAATTCTTCCTGAAGGACTTCTCTACCAAGAGGCAGATTATTGACGCCATCAACAAAGTGGTCTACAAAGGGGGAAGACACGCCAACACTAAGGTGGGCCTTGAGCACCTGCGGGTAAACCACTTTGTGCCTGAGGCAGGCAGCCGCCTGGACCAGCGGGTCCCTCAGATTGCCTTTGTGATCACGGGAGGAAAGTCGGTGGAAGATGCACAGGATGTGAGCCTGGCCCTCACCCAGAGGGGGGTCAAAGTGTTTGCTGTTGGAGTGAGGAATATCGACTCGGAGGAGGTTGGAAAGATAGCGTCCAACAGCGCCACAGCGTTCCGCGTGGGCAACGTCCAGGAGCTGTCCGAACTGAGCGAGCAAGTTTTGGAAACTTTGCATGATGCGATGCATGAAACCCTTTGCCCTGGTGTAACTGATGCTGCCAAAGCTTGTAATCTGGATGTGATTCTGGGGTTTGATGGTTCTAGAGACCAGAATGTTTTTGTGGCCCAGAAGGGCTTCGAGTCCAAGGTGGACGCCATCTTGAACAGAATCAGCCAGATGCACAGGGTCAGCTGCAGCGGTGGCCGCTCGCCCACCGTGCGTGTGTCAGTGGTGGCCAACACGCCCTCGGGCCCGGTGGAGGCCTTTGACTTTGACGAGTACCAGCCAGAGATGCTCGAGAAGTTCCGGAACATGCGCAGCCAGCACCCCTACGTCCTCACGGAGGACACCCTGAAGGTCTACCTGAACAAGTTCAGACAGTCCTCGCCGGACAGCGTGAAGGTGGTCATTCATTTTACTGATGGAGCAGACGGAGATCTGGCTGATTTACACAGAGCATCTGAGAACCTCCGCCAAGAAGGAGTCCGTGCCTTGATCCTGGTGGGCCTTGAACGAGTGGTCAACTTGGAGCGGCTAATGCATCTGGAGTTTGGGCGAGGGTTTATGTATGACAGGCCCCTGAGGCTTAACTTGCTGGACTTGGATTATGAACTAGCGGAGCAGCTTGACAACATTGCCGAGAAAGCTTGCTGTGGGGTTCCCTGCAAGTGCTCTGGGCAGAGGGGAGACCGCGGGCCCATCGGCAGCATCGGGCCAAAGGGTATTCCTGGAGAAGACGGCTACCGAGGCTATCCTGGTGATGAGGGTGGACCCGGTGAGCGTGGTCCGCCTGGTGTGAACGGCACTCAAGGTTTCCAGGGCTGCCCGGGCCAGAGAGGAGTAAAGGGCTCTCGGGGATTCCCAGGAGAGAAGGGCGAAGTAGGAGAAATTGGACTGGATGGTCTGGATGGTGAAGATGGAGACAAAGGATTGCCTGGTTCTTCTGGAGAGAAAGGGAATCCTGGAAGAAGGGGTGATAAAGGACCTCGAGGAGAGAAAGGAGAAAGAGGAGATGTTGGGATTCGAGGGGACCCGGGTAACCCAGGACAAGACAGCCAGGAGAGAGGACCCAAAGGAGAAACCGGTGACCTCGGCCCCATGGGTGTCCCAGGGAGAGATGGAGTACCTGGAGGACCTGGAGAAACTGGGAAGAATGGTGGCTTTGGCCGAAGGGGACCCCCCGGAGCTAAGGGCAACAAGGGCGGTCCTGGCCAGCCGGGCTTTGAGGGAGAGCAGGGGACCAGAGGTGCACAGGGCCCAGCTGGTCCTGCTGGTCCTCCAGGGCTGATAGGAGAACAAGGCATTTCTGGACCTCGGGGAAGCGGAGGTGCCGCTGGTGCTCCTGGAGAACGAGGCAGAACCGGTCCACTGGGAAGAAAGGGTGAGCCCGGAGAGCCAGGACCAAAAGGAGGAATCGGGAACCGGGGCCCTCGTGGGGAGACGGGAGATGACGGGAGAGACGGAGTTGGCAGTGAAGGACGCAGAGGCAAAAAAGGAGAAAGAGGATTCCCTGGATACCCAGGACCAAAGGGTAACCCAGGTGAACCTGGGCTAAATGGAACAACAGGACCCAAAGGCATCAGAGGCCGAAGGGGAAATTCGGGACCTCCAGGGATAGTTGGACAGAAGGGAGACCCTGGCTACCCAGGACCAGCTGGTCCCAAGGGCAACAGGGGCGACTCCATCGATCAATGTGCCCTCATCCAAAGCATCAAAGATAAATGCCCTTGCTGTTACGGGCCCCTGGAGTGCCCCGTCTTCCCAACAGAACTAGCCTTTGCTTTAGACACCTCTGAGGGAGTCAACCAAGACACTTTCGGCCGGATGCGAGATGTGGTCTTGAGTATTGTGAATGACCTGACCATTGCTGAGAGCAACTGCCCACGGGGGGCCCGGGTGGCTGTGGTCACCTACAACAACGAGGTGACCACGGAGATCCGGTTTGCTGACTCCAAGAGGAAGTCGGTCCTCCTGGACAAGATTAAGAACCTTCAGGTGGCTCTGACATCCAAACAGCAGAGTCTGGAGACTGCCATGTCGTTTGTGGCCAGGAACACATTTAAGCGTGTGAGGAACGGATTCCTAATGAGGAAAGTGGCTGTTTTCTTCAGCAACACACCCACAAGAGCATCCCCACAGCTCAGAGAGGCTGTGCTCAAGCTCTCAGATGCGGGGATCACCCCCTTGTTCCTTACAAGGCAGGAAGACCGGCAGCTCATCAACGCTTTGCAGATCAATAACACAGCAGTGGGGCATGCGCTTGTCCTGCCTGCAGGGAGAGACCTCACAGACTTCCTGGAGAATGTCCTCACGTGTCATGTTTGCTTGGACATCTGCAACATCGACCCATCCTGTGGATTTGGCAGTTGGAGGCCTTCCTTCAGGGACAGGAGAGCGGCAGGGAGCGATGTGGACATCGACATGGCTTTCATCTTAGACAGCGCTGAGACCACCACCCTGTTCCAGTTCAATGAGATGAAGAAGTACATAGCGTACCTGGTCAGACAACTGGACATGAGCCCAGATCCCAAGGCCTCCCAGCACTTCGCCAGAGTGGCAGTTGTGCAGCACGCGCCCTCTGAGTCCGTGGACAATGCCAGCATGCCACCTGTGAAGGTGGAATTCTCCCTGACTGACTATGGCTCCAAGGAGAAGCTGGTGGACTTCCTCAGCAGGGGAATGACACAGTTGCAGGGAACCAGGGCCTTAGGCAGTGCCATTGAATACACCATAGAGAATGTCTTTGAAAGTGCCCCAAACCCACGGGACCTGAAAATTGTGGTCCTGATGCTGACGGGCGAGGTGCCGGAGCAGCAGCTGGAGGAGGCCCAGAGAGTCATCCTGCAGGCCAAATGCAAGGGCTACTTCTTCGTGGTCCTGGGCATTGGCAGGAAGGTGAACATCAAGGAGGTATACACCTTCGCCAGTGAGCCAAACGACGTCTTCTTCAAATTAGTGGACAAGTCCACCGAGCTCAACGAGGAGCCTTTGATGCGCTTCGGGAGGCTGTTGCCATCCTTCGTCAGCAGTGAAAATGCTTTTTACTTGTCCCCAGATATCAGGAAACAGTGTGATTGGTTCCAAGGGGACCAACCCACAAAGAACCTTGTGAAGTTTGGTCACAAACAAGTAAATGTTCCGAATAACGTTACTTCAAGTCCTACATCCAACCCAGTGACGACAACGAAGCCGGTGACTACGACGAAGCCGGTGACCACCACAACAAAGCCTGTAACCACCACAACAAAGCCTGTGACTATTATAAATCAGCCATCTGTGAAGCCAGCCGCTGCAAAGCCGGCCCCTGCGAAACCTGTGGCTGCCAAGCCTGTGGCCACAAAGATGGCCACTGTTAGACCCCCAGTGGCGGTGAAGCCAGCAACGGCAGCGAAGCCTGTAGCAGCAAAGCCAGCAGCTGTAAGACCCCCCGCTGCTGCTGCTGCAAAACCAGTGGCGACCAAGCCTGAGGTCCCTAGGCCACAGGCAGCCAAACCAGCTGCCACCAAGCCAGCCACCACTAAGCCCATGGTTAAGATGTCCCGTGAAGTCCAGGTGTTTGAGATAACAGAGAACAGCGCCAAACTCCACTGGGAGAGGGCTGAGCCCCCCGGTCCTTATTTTTATGACCTCACCGTCACCTCAGCCCATGATCAGTCCCTGGTTCTGAAGCAGAACCTCACGGTCACGGACCGCGTCATTGGAGGCCTGCTCGCTGGGCAGACATACCATGTGGCTGTGGTCTGCTACCTGAGGTCTCAGGTCAGAGCCACCTACCACGGAAGTTTCAGTACAAAGAAATCTCAGCCCCCACCTCCACAGCCAGCAAGGTCAGCTTCTAGTTCAACCATCAATCTAATGGTGAGCACAGAACCATTGGCTCTCACTGAAACAGATATATGCAAGTTGCCGAAAGACGAAGGAACTTGCAGGGATTTCATATTAAAATGGTACTATGATCCAAACACCAAAAGCTGTGCAAGATTCTGGTATGGAGGTTGTGGTGGAAACGAAAACAAATTTGGATCACAGAAAGAATGTGAAAAGGTTTGCGCTCCTGTGCTCGCCAAACCCGGAGTCATCAGTGTGATGGGAACCTAAGCGTGGGTGGCCAACATCATATACCTCTTGAAGAAGAAGGAGTCAGCCATCGCCAACTTGTCTCTGTAGAAGCTCCGGGTGTAGATTCCCTTGCACTGTATCATTTCATGCTTTGATTTACACTCGAACTCGGGAGGGAACATCCTGCTGCATGACCTATCAGTATGGTGCTAATGTGTCTGTGGACCCTCGCTCTCTGTCTCCAGGCAGTTCTCTCGAATACTTTGAATGTTGTGTAACAGTTAGCCACTGCTGGTGTTTATGTGAACATTCCTATCAATCCAAATTCCCTCTGGAGTTTCATGTTATGCCTGTTGCAGGCAAATGTAAAGTCTAGAAAATAATGCAAATGTCACGGCTACTCTATATACTTTTGCTTGGTTCATTTTTTTTCCCTTTTAGTTAAGCATGACTTTAGATGGGAAGCCTGTGTATCGTGGAGAAACAAGAGACCAACTTTTTCATTCCCTGCCCCCAATTTCCCAGACTAGATTTCAAGCTAATTTTCTTTTTCTGAAGCCTCTAACAAATGATCTAGTTCAGAAGGAAGCAAAATCCCTTAATCTATGTGCACCGTTGGGACCAATGCCTTAATTAAAGAATTTAAAAAAGTTGTAATAGAGAATATTTTTGGCATTCCTCTAATGTTGTGTGTTTTTTTTTTGTGTGTGCTGGAGGGAGGGGATTTAATTTTAATTTTAAAATGTTTAGGAAATTTATACAAAGAAACTTTTTAATAAAGTATATTGAAAGTT