Transcript asmbl_74378

Sequence
Transcript Sequence for observation asmbl_74378 of TGE0017830:
ACTGAGACCTGTCACCCCGACTCAACGTGAGACGCACCGCCCGGACTCACCATGCGTGAATGCATCTCAGTCCACGTGGGGCAGGCAGGTGTCCAGATGGGCAATGCCTGCTGGGAGCTCTATTGCTTGGAACATGGGATTCAGCCTGATGGGCAGATGCCCAGTGACAAGACCATTGGTGGAGGGGACGACTCCTTCACCACCTTCTTCTGTGAAACTGGTGCTGGAAAACACGTACCCCGGGCAGTTTTTGTGGATCTGGAGCCTACGGTCATTGATGAGATCCGAAATGGCCCATACCGACAGCTCTTCCACCCAGAGCAGCTCATCACTGGGAAAGAGGATGCTGCCAACAACTATGCCCGTGGTCACTATACCATTGGCAAGGAGATCATTGACCCAGTGCTGGATCGGATCCGCAAGCTGTCTGACCAGTGCACAGGACTTCAGGGCTTCCTGGTGTTCCACAGCTTTGGTGGGGGCACTGGCTCTGGCTTCACCTCACTCCTGATGGAGCGGCTCTCTGTTGACTATGGCAAGAAATCCAAGCTGGAATTCTCCATCTACCCAGCCCCCCAGGTGTCTACAGCCGTGGTCGAGCCCTACAACTCTATCCTGACCACCCACACCACCCTGGAGCACTCAGACTGTGCCTTCATGGTGGACAACGAAGCAATCTATGACATCTGCCGCCGCAACCTAGACATCGAGCGCCCAACCTACACCAACCTCAATCGCCTCATTAGCCAAATTGTCTCCTCCATCACAGCTTCTCTGCGCTTTGACGGGGCCCTCAATGTGGACCTGACAGAGTTCCAGACCAACCTGGTGCCCTACCCTCGCATCCACTTCCCCCTGGCCACCTATGCACCAGTCATCTCTGCAGAAAAGGCATACCACGAGCAGCTGTCGGTGGCAGAGATCACCAATGCCTGCTTTGAGCCTGCCAACCAGATGGTAAAGTGTGATCCCCGGCACGGCAAGTACATGGCCTGCTGCCTGCTGTACCGTGGAGATGTGGTGCCCAAGGATGTCAACGCTGCCATTGCCGCCATCAAGACCAAGCGCAGCATTCAGTTTGTGGACTGGTGCCCCACAGGCTTCAAGGTTGGTATCAACTACCAGCCTCCCACTGTGGTGCCTGGGGGTGACCTGGCCAAGGTGCAGCGTGCCGTGTGCATGCTGAGCAACACGACCGCCATCGCCGAGGCCTGGGCCCGCCTGGACCACAAGTTCGACCTGATGTATGCCAAGAGGGCGTTTGTGCACTGGTATGTGGGTGAGGGCATGGAGGAGGGTGAGTTCTCCGAGGCCCGTGAGGATATGGCTGCCCTGGAGAAGGATTATGAGGAGGTGGGCATCGACTCCTATGAGGACGAGGATGAGGGAGAAGAATAAAGCAGCTGCCTGGAGCCTATTCACTATGTTTATTGCAAAATCCTTTCGAAATAAACAGTTTCCTTGCACGGTTTCTTGTTCCCTCTGAGTGCTTGAGCTTCTGCTGCCTTCCCCTTCATGCTGCTGCTGCTCTGTTTGCTGTTCATGACCCTTATCCC