Transcript asmbl_74315

Sequence
Transcript Sequence for observation asmbl_74315 of TGE0057074:
GGGGCGGGAGGGGACCGTCCCATATAAGCCCCGGCTCCCGGCGCTCGGACGCCCGCGCCGGCTGTGCTGCACAGGGGGAGGAGAGGGAACCCCAGGCGCGAGCGGGAAGAGGGGACCTGCAGCCACAACTTCTCTGGTCCTCTGCATCCCTTCTGTCCCTCCACCCGTCCCCTTCCCCACCCTCTGGCCCCCACCTTCTTGGAGGCGACAACCCCCGGGAGGCATTAGAAGGGATTTTTCCCGCAGGTTGCGAAGGGAAGCAAACTTGGTGGCAACTTGCCTCCCGGTGCGGGCGTCTCTCCCCCACCGTCTCAACATGCTTAGGGGTCCGGGGCCCGGGCTGCTGCTGCTGGCCGTCCAGTGCCTGGGGACAGCGGTGCCCTCCACGGGAGCCTCGAAGAGCAAGAGGCAGGCTCAGCAAATGGTTCAGCCCCAGTCCCCGGTGGCTGTCAGTCAAAGCAAGCCCGGTTGTTATGACAATGGAAAACACTATCAGATAAATCAACAGTGGGAGCGGACCTACCTAGGCAATGCGTTGGTTTGTACTTGTTATGGAGGAAGCCGAGGTTTTAACTGCGAGAGTAAACCTGAAGCTGAAGAGACTTGCTTTGACAAGTACACTGGGAACACTTACCGAGTGGGTGACACTTATGAGCGTCCTAAAGACTCCATGATCTGGGACTGTACCTGCATCGGGGCTGGGCGAGGGAGAATAAGCTGTACCATCGCAAACCGCTGCCATGAAGGGGGTCAGTCCTACAAGATTGGTGACACCTGGAGGAGACCACATGAGACTGGTGGTTACATGTTAGAGTGTGTGTGTCTTGGTAATGGAAAAGGAGAATGGACCTGCAAGCCCATAGCTGAGAAGTGTTTTGATCATGCTGCTGGGACTTCCTATGTGGTCGGAGAAACGTGGGAGAAGCCCTACCAAGGCTGGATGATGGTAGATTGTACTTGCCTGGGAGAAGGCAGCGGACGCATCACTTGCACTTCTAGAAATAGATGCAACGATCAGGACACAAGGACATCCTATAGAATTGGAGACACCTGGAGCAAGAAGGATAATCGAGGAAACCTGCTCCAGTGCATCTGCACAGGCAACGGCCGAGGAGAGTGGAAGTGTGAGAGGCACACCTCTGTGCAGACCACATCGAGCGGATCTGGCCCCTTCACCGATGTTCGTGCAGCTGTTTACCAACCGCAGCCTCACCCCCAGCCTCCTCCCTATGGCCACTGTGTCACAGACAGTGGTGTGGTCTACTCTGTGGGGATGCAGTGGCTGAAGACACAAGGAAATAAGCAAATGCTTTGCACGTGCCTGGGCAACGGAGTCAGCTGCCAAGAGACAGCTGTAACCCAGACTTACGGTGGCAACTCAAATGGAGAGCCATGTGTCTTACCATTCACCTACAATGGCAGGACGTTCTACTCCTGCACCACAGAAGGGCGACAGGACGGACATCTTTGGTGCAGCACAACTTCGAATTATGAGCAGGACCAGAAATACTCTTTCTGCACAGACCACACTGTTTTGGTTCAGACTCGAGGAGGAAATTCCAATGGTGCCTTGTGCCACTTCCCCTTCCTATACAACAACCACAATTACACTGATTGCACTTCTGAGGGCAGAAGAGACAACATGAAGTGGTGTGGGACCACACAGAACTATGATGCCGACCAGAAGTTTGGGTTCTGCCCCATGGCTGCCCACGAGGAAATCTGCACAACCAATGAAGGGGTCATGTACCGCATTGGAGATCAGTGGGATAAGCAGCATGACATGGGTCACATGATGAGGTGCACGTGTGTTGGGAATGGTCGTGGGGAATGGACATGCATTGCCTACTCGCAGCTTCGAGATCAGTGCATTGTTGATGACATCACTTACAATGTGAACGACACATTCCACAAGCGTCATGAAGAGGGGCACATGCTGAACTGTACATGCTTCGGTCAGGGTCGGGGCAGGTGGAAGTGTGATCCCGTCGACCAATGCCAGGATTCAGAGACTGGGACGTTTTATCAAATTGGAGATTCATGGGAGAAGTATGTGCATGGTGTCAGATACCAGTGCTACTGCTATGGCCGTGGCATTGGGGAGTGGCATTGCCAACCTTTACAGACCTATCCAAGCTCAAGTGGTCCTGTCGAAGTATTTATCACTGAGACTCCGAGTCAGCCCAACTCCCACCCCATCCAGTGGAATGCACCACAGCCATCTCACATTTCCAAGTACATTCTCAGGTGGAGACCTAAAAATTCTGTAGGCCGTTGGAAGGAAGCTACCATACCAGGCCACTTAAACTCCTACACCATCAAAGGCCTGAAGCCTGGTGTGGTATACGAGGGCCAGCTCATCAGCATCCAGCAGTACGGCCACCAAGAAGTGACTCGCTTTGACTTCACCACCACCAGCACCAGCACACCTGTGACCAGCAACACCGTGACAGGAGAGACGACTCCCTTTTCTCCTCTTGTGGCCACTTCTGAATCTGTGACCGAAATCACAGCCAGTAGCTTTGTGGTCTCCTGGGTCTCAGCTTCCGACACCGTGTCGGGATTCCGGGTGGAATATGAGCTGAGTGAGGAGGGAGATGAGCCACAGTACCTGGATCTTCCAAGCACAGCCACTTCTGTGAACATCCCTGACCTGCTTCCTGGCCGAAAATACATTGTAAATGTCTATCAGATATCTGAGGATGGGGAGCAGAGTTTGATCCTGTCTACTTCACAAACAACAGCGCCTGATGCCCCTCCTGACACGACTGTGGACCAAGTTGATGACACCTCAATTGTTGTTCGCTGGAGCAGACCCCAGGCTCCCATCACAGGGTACAGAATAGTCTATTCGCCATCAGTAGAAGGTAGCAGCACAGAACTCAACCTTCCTGAAACTGCAAACTCCGTCACCCTCAGTGACTTGCAACCTGGTGTTCAGTATAACATCACTATCTATGCTGTGGAAGAAAATCAAGAAAGTACACCTGTTGTCATTCAACAAGAAACCACTGGCACCCCACGCTCAGATACAGTGCCCTCTCCCAGGGACCTGCAGTTTGTGGAAGTGACAGACGTGAAGGTCACCATCATGTGGACACCGCCTGAGAGTGCAGTGACCGGCTACCGTGTGGATGTGATCCCCGTCAACCTGCCTGGCGAGCACGGGCAGAGGCTGCCCATCAGCAGGAACACCTTTGCAGAAGTCACCGGGCTGTCCCCTGGGGTCACCTATTACTTCAAAGTCTTTGCAGTGAGCCATGGGAGGGAGAGCAAGCCTCTGACTGCTCAACAGACAACCAAACTGGATGCTCCCACTAACCTCCAGTTTGTCAATGAAACTGATTCTACTGTCCTGGTGAGATGGACTCCACCTCGGGCCCAGATAACAGGATACCGACTGACCGTGGGCCTTACCCGAAGAGGACAGCCCAGGCAGTACAATGTGGGTCCCTCTGTCTCCAAGTACCCACTGAGGAATCTGCAGCCTGCATCTGAGTACACCGTATCCCTCGTGGCCATAAAGGGCAACCAAGAGAGCCCCAAAGCCACTGGAGTCTTTACCACACTGCAGCCTGGGAGCTCTATTCCACCTTACAACACCGAGGTGACTGAGACCACCATTGTGATCACATGGACGCCTGCTCCAAGAATTGGTTTTAAGCTGGGTGTACGACCAAGCCAGGGAGGAGAGGCACCACGAGAAGTGACTTCAGACTCAGGAAGCATCGTTGTGTCCGGCTTGACTCCAGGAGTAGAATACGTCTACACCATCCAAGTCCTGAGAGATGGACAGGAAAGAGATGCGCCAATTGTAAACAAAGTGGTGACACCATTGTCTCCACCAACAAACTTGCATCTGGAGGCAAACCCTGACACTGGAGTGCTCACAGTCTCCTGGGAGAGGAGCACCACCCCAGACATTACTGGTTATAGAATTACCACAACCCCTACAAACGGCCAGCAGGGAAATTCTTTGGAAGAAGTGGTCCATGCTGATCAGAGCTCCTGCACTTTTGATAACCTGAGTCCCGGCCTGGAGTACAATGTCAGTGTTTACACTGTCAAGGATGACAAGGAAAGTGTCCCTATCTCTGATACCATCATCCCAGCTGTTCCTCCTCCCACTGACCTGCGATTCACCAACATTGGTCCAGACACCATGCGTGTCACCTGGGCTCCACCCCCATCCATTGATTTAACCAACTTCCTGGTGCGTTACTCACCTGTGAAAAATGAGGAAGATGTTGCAGAGTTGTCAATTTCTCCTTCAGACAATGCAGTGGTCTTAACAAATCTCCTGCCTGGTACAGAATATGTAGTGAGTGTCTCCAGTGTCTACGAACAACATGAGAGCACACCTCTTAGAGGAAGACAGAAAACAGGTCTTGATTCCCCAACTGGCATTGACTTTTCTGATATTACTGCCAACTCTTTTACTGTGCACTGGATTGCTCCTCGAGCCACCATCACTGGCTACAGGATCCGCCATCATCCCGAGCACTTCAGTGGGAGACCTCGAGAAGATCGGGTGCCCCACTCTCGGAATTCCATCACCCTCACCAACCTCACTCCAGGCACAGAGTATGTGGTCAGCATCGTTGCTCTTAATGGCAGAGAGGAAAGTCCCTTATTGATTGGCCAACAATCAACAGTTTCTGATGTTCCGAGGGACCTGGAAGTTGTTGCTGCGACCCCCACCAGCCTACTGATCAGCTGGGATGCTCCTGCTGTCACAGTGAGATATTACAGGATCACTTACGGAGAGACAGGAGGAAATAGCCCTGTCCAGGAGTTCACTGTGCCTGGGAGCAAGTCTACAGCTACCATCAGCGGCCTTAAACCTGGAGTTGATTATACCATCACTGTGTATGCTGTCACTGGCCGTGGAGACAGCCCCGCAAGCAGCAAGCCAATTTCCATTAATTACCGAACAGAAATTGACAAACCATCCCAGATGCAAGTGACCGATGTTCAGGACAACAGCATTAGTGTCAAGTGGCTGCCTTCAAGTTCCCCTGTTACTGGTTACAGAGTAACCACCACTCCCAAAAATGGACCAGGACCAACAAAAACTAAAACTGCAGGTCCAGATCAAACAGAAATGACTATTGAAGGCTTGCAGCCCACAGTGGAGTATGTGGTTAGTGTCTATGCTCAGAATCCAAGCGGAGAGAGTCAGCCTCTGGTTCAGACTGCAGTAACCACTATTCCTGCACCAACTGACCTGAAGTTCACTCAGGTCACACCCACAAGCCTGAGCGCCCAGTGGACACCACCCAATGTTCAGCTCACTGGATATCGAGTGCGGGTGACCCCCAAGGAGAAGACCGGACCAATGAAAGAAATCAACCTTGCTCCTGACAGCTCATCCGTGGTTGTATCAGGACTTATGGTGGCCACCAAATATGAAGTGAGTGTCTATGCTCTTAAGGACACTTTGACAAGCAGACCAGCTCAGGGAGTTGTCACCACTCTGGAGAATGTCAGCCCACCAAGAAGGGCTCGTGTGACAGATGCTACTGAGACCACCATCACCATTAGCTGGAGAACCAAGACTGAGACGATCACTGGCTTCCAAGTTGATGCCGTTCCAGCCAATGGCCAGACTCCAATCCAGAGAACCATCAAGCCAGATGTCAGAAGCTACACCATCACAGGTTTACAACCAGGCACTGACTACAAGATCTACCTGTACACCTTGAATGACAATGCTCGGAGCTCCCCTGTGGTCATCGACGCCTCCACTGCCATTGATGCACCATCCAACCTGCGTTTCCTGGCCACCACACCCAATTCCTTGCTGGTATCATGGCAGCCGCCACGTGCCAGGATTACCGGCTACATCATCAAGTATGAGAAGCCTGGGTCTCCTCCCAGAGAAGTGGTCCCTCGGCCCCGCCCTGGTGTCACAGAGGCTACTATTACTGGCCTGGAACCGGGAACCGAATATACAATTTATGTCATTGCCCTGAAGAATAATCAGAAGAGCGAGCCCCTGATTGGAAGGAAAAAGACAGACGAGCTTCCCCAACTGGTAACCCTTCCACACCCCAATCTTCATGGACCAGAGATCTTGGATGTTCCTTCCACAGTTCAAAAGACCCCTTTCGTCACCCACCCTGGGTATGACACTGGAAATGGTATTCAGCTTCCTGGCACTTCTGGTCAGCAACCCAGTGTTGGGCAACAAATGATCTTTGAGGAACATGGTTTTAGGCGGACCACACCGCCCACAACGGCCACCCCCATAAGGCATAGGCCAAGACCATACCCGCCGAATGTAGGACAAGAAGCTCTCTCTCAGACAACCATCTCATGGGCCCCATTCCAGGACACTTCTGAGTACATCATTTCATGTCATCCTGTTGGCACTGATGAAGAACCCTTACAGTTCAGGGTTCCTGGAACTTCTACCAGTGCCACTCTGACAGGCCTCACCAGAGGTGCCACCTACAACGTCATAGTGGAGGCACTGAAAGACCAGCAGAGGCATAAGGTTCGGGAAGAGGTTGTTACCGTGGGCAACTCTGTCAACGAAGGCTTGAACCAACCTACGGATGACTCGTGCTTTGACCCCTACACAGTTTCCCATTATGCCGTTGGAGATGAGTGGGAACGAATGTCTGAATCAGGCTTTAAACTGTTGTGCCAGTGCTTAGGCTTTGGAAGTGGTCATTTCAGATGTGATTCATCTAGATGGTGCCATGACAATGGTGTGAACTACAAGATTGGAGAGAAGTGGGACCGTCAGGGAGAAAATGGCCAGATGATGAGCTGCACATGTCTTGGGAACGGAAAAGGAGAATTCAAGTGTGACCCTCATGAGGCAACGTGTTATGATGATGGGAAGACATACCACGTAGGAGAACAGTGGCAGAAGGAATATCTCGGTGCCATTTGCTCCTGCACATGCTTTGGAGGCCAGCGGGGCTGGCGCTGTGACAACTGCCGCAGACCTGGGGGTGAACCCAGTCCCGAAGGCACTACTGGCCAGTCCTACAACCAGTATTCTCAGAGATACCATCAGAGAACAAACACTAATGTTAATTGCCCAATTGAGTGCTTCATGCCTTTAGATGTACAGGCTGACAGAGAAGATTCCCGAGAGTAAATCATCTTTCCAATCCAGAGGAACAAGCATGTCTCTCTGCCAAGATCCATCTAAACTGGAGTGATGTTAGCAGACCCAGCTTAGAGTTCTTCTTTCTTTCTTAAGCCCTTTGCTCTGGAGGAAGTTCTCCAGCTTCAGCTCAACTCACAGCTTCTCCAAGCATCACCCTGGGAGTTTCCTGAGGGTTTTCTCATAAATGAGGGCTGCACATTGCCTGTTCTGCTTCGAAGTATTCAATACCGCTCAGTATTTTAAATGAAGTGATTCTAAGATTTGGTTTGGGATCAATAGGAAAGCATATGCAGCCAACCAAGATGCAAATGTTTTGAAATGATATGACCAAAATTTTAAGTAGGAAAGTCACCCAAACACTTCTGCTTTCACTTAAGTGTCTGGCCCGCAATACTGTAGGAACAAGCATGATCTTGTTACTGTGATATTTTAAATATCCACAGTACTCACTTTTTCCAAATGATCCTAGTAATTGCCTAGAAATATCTTTCTCTTACCTGTTATTTATCAATTTTTCCCAGTATTTTTATACGGAAAAAATTGTATTGAAAACACTTAGTATGCAGTTGATAAGAGGAATTTGGTATAATTATGGTGGGTGATTATTTTTTATACTGTATGTGCCAAAGCTTTACTACTGTGGAAAGACAACTGTTTTAATAAAAGATTTACATTCCACAACTTGAAGTTCATCTATTTGATATAAGACACCTTCGGGGGAAATAATTCCTGTGAATATTCTTTTTCAATTCAGCAAACATTTGAAAATCTATGATGTGCAAGTCTAATTGTTGATTTCAGTACAAGATTTTCTAAATCAGTTGCTACAAAAACTGATTGGTTTTTGTCACTTCATCTCTTCACTAATGGAGATAGCTTTACACTTTCTGCTTTAATAGATTTAAGTGGACCCCAATATTTATTAAAATTGCTAGTTTACCGTTCAGAAGTATAATAGAAATAATCTTTAGTTGCTCTTTTCTAACCATTGTAATTCTTCCCTTCTTCCCTCCACCTTTCCTTCATTGAATAAACCTCTGTTCAAAGAGATTGCCTGCAAGGGAAATAAAAATGACTAAGATATTAAAAGTATTTGAATAGTATAATATGGAGGAGTTTTATCTTAGGGAAACCCCATGGTATGATAACCCCCATCTAACATGTCTTACTTTGGGTCAGCTGACACTTTTGGCATGGCTTGATAAACTCCCAGCTAAACAGTTTGTTTACTCCTGATCTGTAAAGGTCATTTCTTTTTCAATTTAACATTGAGGAAACAAACTTTGGGATTAAATTTGACATTCAGGCCAGGCGCAGTGGCTCAC