Transcript asmbl_74204

Sequence
Transcript Sequence for observation asmbl_74204 of TGE0057068:
GGAGGGGACACGGGCTCATTGCGGTGTGCGCCCTGCACTCTGTCCCTCACTCGCCGCCGACGACCTGTCTCGCCGAGCGCACGCCTTGCCGCCGCCCCGCAGAAATGCTTCGGTTACCCACAGTCTTTCGCCAGATGAGACCGGTGTCCAGGGTACTGGCTCCTCATCTCACTCGGGCTTATGCCAAAGATGTAAAATTTGGTGCAGATGCCCGAGCCTTAATGCTTCAAGGTGTAGACCTTTTAGCCGATGCTGTGGCCGTTACAATGGGGCCAAAGGGAAGAACAGTGATTATTGAGCAGAGTTGGGGAAGTCCCAAAGTAACAAAAGATGGTGTGACTGTTGCAAAGTCAATTGACTTAAAAGATAAATACAAAAACATTGGAGCTAAACTTGTTCAAGATGTTGCCAATAACACAAATGAAGAAGCTGGGGATGGCACTACCACTGCTACTGTACTGGCACGCTCTATAGCCAAGGAAGGCTTCGAGAAGATTAGCAAAGGTGCTAATCCAGTGGAAATCAGGAGAGGTGTGATGTTAGCTGTTGATGCTGTAATTGCTGAACTTAAAAAGCAGTCTAAACCTGTGACCACCCCTGAAGAAATTGCACAGGTTGCTACGATTTCTGCAAACGGAGACAAAGAAATTGGCAATATCATCTCTGATGCAATGAAAAAAGTTGGAAGAAAGGGTGTCATCACAGTAAAGGATGGAAAAACACTGAATGATGAATTAGAAATTATTGAAGGCATGAAGTTTGATCGAGGCTATATTTCTCCATACTTTATTAATACATCAAAAGGTCAGAAATGTGAATTCCAGGATGCCTATGTTCTGTTGAGTGAAAAGAAAATTTCTAGTATCCAGTCCATTGTACCTGCTCTTGAAATTGCCAATGCTCACCGTAAGCCTTTGGTCATAATCGCTGAAGATGTTGATGGAGAAGCTCTAAGTACACTCGTCTTGAATAGGCTAAAGGTTGGTCTTCAGGTTGTGGCAGTCAAGGCTCCAGGGTTTGGTGACAATAGAAAGAACCAGCTTAAAGATATGGCTATTGCTACTGGTGGTGCAGTGTTTGGAGAAGAGGGATTGACCCTGAATCTTGAAGACGTTCAGCCTCATGACTTAGGAAAAGTTGGAGAGGTCATTGTGACCAAAGACGATGCCATGCTCTTAAAAGGAAAAGGTGACAAGGCTCAAATTGAAAAACGTATTCAAGAAATCATTGAGCAGTTAGATGTCACAACTAGTGAATATGAAAAGGAAAAACTGAATGAACGGCTTGCAAAACTTTCAGATGGAGTGGCTGTGCTGAAGGTTGGTGGGACAAGTGATGTTGAAGTGAATGAAAAGAAAGACAGAGTTACAGATGCCCTTAATGCTACAAGAGCTGCTGTTGAAGAAGGCATTGTTTTGGGAGGGGGTTGTGCCCTCCTTCGATGCATTCCAGCCTTGGACTCATTGACTCCAGCTAATGAAGATCAAAAAATTGGTATAGAAATTATTAAAAGAACACTCAAAATTCCAGCAATGACCATTGCTAAGAATGCAGGTGTTGAAGGATCTTTGATAGTTGAGAAAATTATGCAAAGTTCCTCAGAAGTTGGTTATGATGCTATGGCTGGAGATTTTGTGAATATGGTGGAAAAAGGAATCATTGACCCAACAAAGGTTGTGAGAACTGCTTTATTGGATGCTGCTGGTGTGGCCTCTCTGTTAACTACAGCAGAAGTTGTAGTCACAGAAATTCCTAAAGAAGAGAAGGACCCTGGAATGGGTGCAATGGGTGGAATGGGAGGTGGTATGGGAGGTGGCATGTTCTAACTCCTAGACTAGTGCTTTACCTTTATTAATGAACTGTGACAGGAAGCCCAAGGCAGTGTTCCTCACCAATAACTTCAGAGAAGTCAGTTGGAGAAAATGAAGAAAAAGGCTGGCTGAAAATCACTATAACCATCAGTTACTGGTTTCAGTTGACAAAATATATAATGGTTTACTGCTGTCATTGTCCATGCCTACAGATAATTTATTTTGTATTTTTGAATAAAAAACATTTGTACATTCCTGATACTGGGTACAAGAGCCATGTACCAGTGTACTGCTTTCAACTTAAATCACTGAGGCATTTTTACTACTATTCTGTTAAAATCAGGATTTTAGTGCTTGCCACCACCAGATGAGAAGTTAAGCAGCCTTTCTGTGGAGAGTGAGAATAATTGTGTACAAAGTAGAGAAGTATCCAATTATGTGACAACCTTTGTGTAATAAAAATTTGTTTAAAGTTAATAATTGTGTTAGCATTTCCATGATTAGAAGATACTGAAAATTGAAAGCCAGTTGAAGGGCAGGCTGGCATGTGTGTAAAACATTATCCTATCTATGATATTTTCATGTTTCTCTTTGTTGCAGACTGAACTACATTATTCCATTGATAATGGGGAAAGACAGTTTCTATTTTCCCCGGTGCAAGGATGTAATCTCTCTTGGAGCTGTAAAATCTGGGAGGTTGGAGGGAACTCCAGCTCCTCAGCATGGCCTTTGGGCTGCTGCTGCAAGCAAGGCATTGAGGCAAATATTTTTGCTGTCCTTACCTTGGACAGAAGTAGAGGGGAGAAATAAAGTCCATCATCACATGAAAAGTCAGTCACTTGAAATCCTGTACCTAGAATACCTTTGGCTTTGGTAATTTCGTTGTGTTTGGGGTACAAAAAAAAG