Transcript asmbl_74203

Sequence
Transcript Sequence for observation asmbl_74203 of TGE0056300:
GGAGGGGACACGGGCTCATTGCGGTGTGCGCCCTGCACTCTGTCCCTCACTCGCCGCCGACGACCTGTCTCGCCGAGCGCACGCCTTGCCGCCGCCCCGCAGAAATGCTTCGGTTACCCACAGTCTTTCGCCAGATGAGACCGGTGTCCAGGGTACTGGCTCCTCATCTCACTCGGGCTTATGCCAAAGATGTAAAATTTGGTGCAGATGCCCGAGCCTTAATGCTTCAAGGTGTAGACCTTTTAGCCGATGCTGTGGCCGTTACAATGGGGCCAAAGGGAAGAACAGTGATTATTGAGCAGAGTTGGGGAAGTCCCAAAGTAACAAAAGATGGTGTGACTGTTGCAAAGTCAATTGACTTAAAAGATAAATACAAAAACATTGGAGCTAAACTTGTTCAAGATGTTGCCAATAACACAAATGAAGAAGCTGGGGATGGCACTACCACTGCTACTGTACTGGCACGCTCTATAGCCAAGGAAGGCTTCGAGAAGATTAGCAAAGGTGCTAATCCAGTGGAAATCAGGAGAGGTGTGATGTTAGCTGTTGATGCTGTAATTGCTGAACTTAAAAAGCAGTCTAAACCTGTGACCACCCCTGAAGAAATTGCACAGGTAAGGACTTAACATGTTACACGTTTTTTAAAAAAAATTTAATGGCATGTGTGATTTTTTTTTTCCCTTGATCACACCAATGTCAGAATAACAATACTACCCAATCATCAATATTAGAATCATTGTTTCTTACTGCTAAAACCTTTGAAAAGAATTATGACCATAATGGTTGTCATTTAGTTCTACATGTGGTTGTCATTTTAGTTCTACATGGCTGTAAAATGGATTCATATGATTGTGAAAATGTTCTTAGCCATTGTCAAAGGTGCATAAGTTTTGTCAGTTTGTAATGAAGTCAGCATTTTTAAACTTTTTGTTACAAGAATAGTTTTATGTATCATATTCTTCAAAACAATGTAGTCAAATAATGAATCGGAAAAGAGCAAAGAACCAGTACTTCATGAAAACTACCATAACGTAAATTCCCCTTCTCTCCCCTGGATGGAAGTATCAATTTGGAAGTTACTAGGAAAAGGTAAGGGAACTGACTGAGGACACTAGGCTTACCTTTTAATTTCGAAGAGTAACTGGATTATTTCAGGTTGCTACGATTTCTGCAAACGGAGACAAAGAAATTGGCAATATCATCTCTGATGCAATGAAAAAAGTTGGAAGAAAGGGTGTCATCACAGTAAAGGATGGAAAAACACTGAATGATGAATTAGAAATTATTGAAGGCATGAAGTTTGATCGAGGCTATATTTCTCCATACTTTATTAATACATCAAAAGGTCAGAAATGTGAATTCCAGGATGCCTATGTTCTGTTGAGTGAAAAGAAAATTTCTAGTATCCAGTCCATTGTACCTGCTCTTGAAATTGCCAATGCTCACCGTAAGCCTTTGGTCATAATCGCTGAAGATGTTGATGGAGAAGCTCTAAGTACACTCGTCTTGAATAGGCTAAAGGTTGGTCTTCAGGTTGTGGCAGTCAAGGCTCCAGGGTTTGGTGACAATAGAAAGAACCAGCTTAAAGATATGGCTATTGCTACTGGTGGTGCAGTGTTTGGAGAAGAGGGATTGACCCTGAATCTTGAAGACGTTCAGCCTCATGACTTAGGAAAAGTTGGAGAGGTCATTGTGACCAAAGACGATGCCATGCTCTTAAAAGGAAAAGGTGACAAGGCTCAAATTGAAAAACGTATTCAAGAAATCATTGAGCAGTTAGATGTCACAACTAGTGAATATGAAAAGGAAAAACTGAATGAACGGCTTGCAAAACTTTCAGATGGAGTGGCTGTGCTGAAGGTTGGTGGGACAAGTGATGTTGAAGTGAATGAAAAGAAAGACAGAGTTACAGATGCCCTTAATGCTACAAGAGCTGCTGTTGAAGAAGGCATTGTTTTGGGAGGGGGTTGTGCCCTCCTTCGATGCATTCCAGCCTTGGACTCATTGACTCCAGCTAATGAAGATCAAAAAATTGGTATAGAAATTATTAAAAGAACACTCAAAATTCCAGCAATGACCATTGCTAAGAATGCAGGTGTTGAAGGATCTTTGATAGTTGAGAAAATTATGCAAAGTTCCTCAGAAGTTGGTTATGATGCTATGGCTGGAGATTTTGTGAATATGGTGGAAAAAGGAATCATTGACCCAACAAAGGTTGTGAGAACTGCTTTATTGGATGCTGCTGGTGTGGCCTCTCTGTTAACTACAGCAGAAGTTGTAGTCACAGAAATTCCTAAAGAAGAGAAGGACCCTGGAATGGGTGCAATGGGTGGAATGGGAGGTGGTATGGGAGGTGGCATGTTCTAACTCCTAGACTAGTGCTTTACCTTTATTAATGAACTGTGACAGGAAGCCCAAGGCAGTGTTCCTCACCAATAACTTCAGAGAAGTCAGTTGGAGAAAATGAAGAAAAAGGCTGGCTGAAAATCACTATAACCATCAGTTACTGGTTTCAGTTGACAAAATATATAATGGTTTACTGCTGTCATTGTCCATGCCTACAGATAATTTATTTTGTATTTTTGAATAAAAAACATTTGTACATTCCTGATACTGGGTACAAGAGCCATGTACCAGTGTACTGCTTTCAACTTAAATCACTGAGGCATTTTTACTACTATTCTGTTAAAATCAGGATTTTAGTGCTTGCCACCACCAGATGAGAAGTTAAGCAGCCTTTCTGTGGAGAGTGAGAATAATTGTGTACAAAGTAGAGAAGTATCCAATTATGTGACAACCTTTGTGTAATAAAAATTTGTTTAAAGTTAATAATTGTGTTAGCATTTCCATGATTAGAAGATACTGAAAATTGAAAGCCAGTTGAAGGGCAGGCTGGCATGTGTGTAAAACATTATCCTATCTATGATATTTTCATGTTTCTCTTTGTTGCAGACTGAACTACATTATTCCATTGATAATGGGGAAAGACAGTTTCTATTTTCCCCGGTGCAAGGATGTAATCTCTCTTGGAGCTGTAAAATCTGGGAGGTTGGAGGGAACTCCAGCTCCTCAGCATGGCCTTTGGGCTGCTGCTGCAAGCAAGGCATTGAGGCAAATATTTTTGCTGTCCTTACCTTGGACAGAAGTAGAGGGGAGAAATAAAGTCCATCATCACATGAAAAGTCAGTCACTTGAAATCCTGTACCTAGAATACCTTTGGCTTTGGTAATTTCGTTGTGTTTGGGGTACAAAAAAAAG