Transcript asmbl_74202

Sequence
Transcript Sequence for observation asmbl_74202 of TGE0056302:
AAGTGCCGGGATTACAGGCCTGAGTCACCACGCCCGGCCAGGCCAACAGTTTATTAAGAAGGTAAACGGATATGGACAAGTATAATTAATAGAAAATAGCCTAAACTGTCTCAGATACTTCCTGTCTTAATTTGATCAAAAATTGCTAGGAAGCAAAAAAAAAACAAAAAAACACAAAAACCAAACCAGATTACTTAGGGAGTCCTAAGTAATCTAGTAACAGCTTGAGGGGAATTAAACAGATAGGCATTTTTATTTCATTTAAATCTTACTATCAACTATTCTTAACAGGCTAAAGGTTGGTCTTCAGGTTGTGGCAGTCAAGGCTCCAGGGTTTGGTGACAATAGAAAGAACCAGCTTAAAGATATGGCTATTGCTACTGGTGGTGCAGTGTTTGGAGAAGAGGGATTGACCCTGAATCTTGAAGACGTTCAGCCTCATGACTTAGGAAAAGTTGGAGAGGTCATTGTGACCAAAGACGATGCCATGCTCTTAAAAGGAAAAGGTGACAAGGCTCAAATTGAAAAACGTATTCAAGAAATCATTGAGCAGTTAGATGTCACAACTAGTGAATATGAAAAGGAAAAACTGAATGAACGGCTTGCAAAACTTTCAGATGGAGTGGCTGTGCTGAAGGTTGGTGGGACAAGTGATGTTGAAGTGAATGAAAAGAAAGACAGAGTTACAGATGCCCTTAATGCTACAAGAGCTGCTGTTGAAGAAGGCATTGTTTTGGGAGGGGGTTGTGCCCTCCTTCGATGCATTCCAGCCTTGGACTCATTGACTCCAGCTAATGAAGATCAAAAAATTGGTATAGAAATTATTAAAAGAACACTCAAAATTCCAGCAATGACCATTGCTAAGAATGCAGGTGTTGAAGGATCTTTGATAGTTGAGAAAATTATGCAAAGTTCCTCAGAAGTTGGTTATGATGCTATGGCTGGAGATTTTGTGAATATGGTGGAAAAAGGAATCATTGACCCAACAAAGGTTGTGAGAACTGCTTTATTGGATGCTGCTGGTGTGGCCTCTCTGTTAACTACAGCAGAAGTTGTAGTCACAGAAATTCCTAAAGAAGAGAAGGACCCTGGAATGGGTGCAATGGGTGGAATGGGAGGTGGTATGGGAGGTGGCATGTTCTAACTCCTAGACTAGTGCTTTACCTTTATTAATGAACTGTGACAGGAAGCCCAAGGCAGTGTTCCTCACCAATAACTTCAGAGAAGTCAGTTGGAGAAAATGAAGAAAAAGGCTGGCTGAAAATCACTATAACCATCAGTTACTGGTTTCAGTTGACAAAATATATAATGGTTTACTGCTGTCATTGTCCATGCCTACAGATAATTTATTTTGTATTTTTGAATAAAAAACATTTGTACATTCCTGATACTGGGTACAAGAGCCATGTACCAGTGTACTGCTTTCAACTTAAATCACTGAGGCATTTTTACTACTATTCTGTTAAAATCAGGATTTTAGTGCTTGCCACCACCAGATGAGAAGTTAAGCAGCCTTTCTGTGGAGAGTGAGAATAATTGTGTACAAAGTAGAGAAGTATCCAATTATGTGACAACCTTTGTGTAATAAAAATTTGTTTAAAGTTAATAATTGTGTTAGCATTTCCATGATTAGAAGATACTGAAAATTGAAAGCCAGTTGAAGGGCAGGCTGGCATGTGTGTAAAACATTATCCTATCTATGATATTTTCATGTTTCTCTTTGTTGCAGACTGAACTACATTATTCCATTGATAATGGGGAAAGACAGTTTCTATTTTCCCCGGTGCAAGGATGTAATCTCTCTTGGAGCTGTAAAATCTGGGAGGTTGGAGGGAACTCCAGCTCCTCAGCATGGCCTTTGGGCTGCTGCTGCAAGCAAGGCATTGAGGCAAATATTTTTGCTGTCCTTACCTTGGACAGAAGTAGAGGGGAGAAATAAAGTCCATCATCACATGAAAAGTCAGTCACTTGAAATCCTGTACCTAGAATACCTTTGGCTTTGGTAATTTCGTTGTGTTTGGGGTACAAAAAAAAG