Transcript asmbl_73374

Sequence
Transcript Sequence for observation asmbl_73374 of TGE0057067:
TCCCCCTTTCCCTCCCTTTCTCCTCCTCCTCCTGCCGCCGCGGCCGCTGCCGGACTTCGCCAGATCAGACCCACGGGGCTGCCCTCCCCTGCGCACTCCCCTCGCTGCCCGGGCCCGGAGCGCAGCGCGGCCGCACAGGTATTTTTGCTGTGCTGTGCAAGGAACTCTGCTAGCTCAAGATTCACAATGTTGAAAGCCCTTTTCCTAACTATGCTGACTCTGGCGCTGGTCAAGTCACAGGACACCGAAGAAACCATCACGTACACGCAATGCACTGACGGATATGAGTGGGATCCTGTGAGACAGCAATGCAAAGATATTGATGAATGTGACATTGTCCCAGACGCTTGTAAAGGTGGAATGAAGTGTGTCAACCACTATGGAGGATACCTCTGCCTTCCGAAAACAGCCCAGATTATTGTCAATAATGAACAGCCTCAGCAGGAAACACAACCAGCAGAAGGAACCTCAGGGGCAACCACCGGGGTTGTAGCTGCCAGCAGCATGGCAACCAGTGGAGTGTTGCCCGGGGGTGGTTTTGTGGCCAGTGCTGCTGCAGTCGCAGGCCCTGAAATGCAGACTGGCCGAAATAACTTTGTCATCCGGCGGAACCCAGCTGACCCTCAGCGCATTCCCTCCAACCCTTCCCACCGTATCCAGTGTGCAGCAGGCTACGAGCAAAGTGAACACAACGTGTGCCAAGACATAGACGAGTGCACTGCAGGGACGCACAACTGTAGAGCAGACCAAGTGTGCATCAATTTACGGGGATCCTTTGCATGTCAGTGCCCTCCTGGATATCAGAAGCGAGGGGAGCAGTGCGTAGACATAGATGAATGTACCATCCCTCCATATTGCCACCAAAGATGCGTGAATACACCAGGCTCATTTTATTGCCAGTGCAGTCCTGGGTTTCAATTGGCAGCAAACAACTATACCTGCGTAGATATAAATGAATGTGATGCCAGCAATCAATGTGCTCAGCAGTGCTACAACATTCTTGGTTCATTCATCTGTCAGTGCAATCAAGGATATGAGCTAAGCAGTGACAGGCTCAACTGTGAAGACATTGATGAATGCAGAACCTCAAGCTACCTGTGTCAATATCAATGTGTCAATGAACCTGGGAAATTCTCATGTATGTGCCCCCAGGGATACCAAGTGGTGAGAAGTAGAACATGTCAAGATATAAATGAGTGTGAGACCACAAATGAATGCCGGGAGGATGAAATGTGTTGGAATTATCATGGCGGCTTCCGTTGTTATCCACGAAATCCTTGTCAAGATCCCTACATTCTAACACCAGAGAACCGATGTGTTTGCCCAGTCTCAAATGCCATGTGCCGAGAACTGCCCCAGTCAATAGTCTACAAATACATGAGCATCCGATCTGATAGGTCTGTGCCATCAGACATCTTCCAGATACAGGCCACAACTATTTATGCCAACACCATCAATACTTTTCGGATTAAATCTGGAAATGAAAATGGAGAGTTCTACCTACGACAAACAAGTCCTGTAAGTGCAATGCTTGTGCTCGTGAAGTCATTATCAGGACCAAGAGAACATATCGTGGACCTGGAGATGCTGACAGTCAGCAGTATAGGGACCTTCCGCACAAGCTCTGTGTTAAGATTGACAATAATAGTGGGGCCATTTTCATTTTAGTCTTTTCTAAGAGTCAACCACAGGCATTTAAGTCAGCCAAAGAATATTGTTACCTTAAAGCACTATTTTATTTATAGATATATCTAGTGCATCTACATCTCTATACTGTACACTCACCCATAATTCAAACAATTACACCATGGTATAAAGTGGGCATTTAATATGTAAAGATTCAAAGTTTGTCTTTATTACTATATGTAAATTAGACATTAATCCACTAAACTGGTCTTCTTCAAGAGAGCTAAGTATACACTATCTGGTGAAACTTGGATTCTTTCCTATAAAAGTGGGACCAAGCAATGATGATCTTCTGTGGTGCTTAAGGAAACTTACTAGAGCTCCACTAACAGTCTCATAAGGAGGCAGCCATCATAACCATTGAATAGCATGCAAGGGTAAGAATGAGTTTTTAACTGCTTTGTAAGAAAATGGAAAAGGTCAATAAAGATATATTTCTTTAGAAAATGGGGATCTGCCATATTTGTGTTGGTTTTTATTTTCATATCCAGCCTAAAGGTGGTTGTTTATTATATAGTAATAAATCATTGCTGTACAATATGCTGGTTTCTGTAGGGTATTTTTAATTTTGTCAGAAATTTTAGATTGTGAATATTTTGTAAAAAACAGTAAGCAAAATTTTCCAGAATTCCCAAAATGAACCAGATATCCCCTAGAAAATTATACTATTGAGAAATCTATGGGGAGGATATGAGAAAATAAATTCCTTCTAAACCACATTGGAACTGACCTGAAGAAGCAAACTCGGAAAATATAATAACATCCCTGAATTCAGGACTTCCACAAGATGCAGAACAAAATGGATAAAAGGTATTTCACTGGAGAAGTTTTAATTTCTAAGTAAAATTTAAATCCTAACACTTCACTAATTTATAACTAAAATTTCTCATCTTCGTACTTGATGCTCACAGAGGAAGAAAATGATGATGGTTTTTATTCCTGGCATCCAGAGTGACAGTGAACTTAAGCAAATTACCCTCCTACCCAATTCTATGGAATATTTTATACGTCTCCTTGTTTAAAATGTCACTGCTTTACTTTGATGTATCATATTTTTAAATAAAAATAAATATTCCTTTAGAA