Transcript asmbl_73373

Sequence
Transcript Sequence for observation asmbl_73373 of TGE0057066:
TCCCCCTTTCCCTCCCTTTCTCCTCCTCCTCCTGCCGCCGCGGCCGCTGCCGGACTTCGCCAGATCAGACCCACGGGGCTGCCCTCCCCTGCGCACTCCCCTCGCTGCCCGGGCCCGGAGCGCAGCGCGGCCGCACAGATTCACAATGTTGAAAGCCCTTTTCCTAACTATGCTGACTCTGGCGCTGGTCAAGTCACAGGACACCGAAGAAACCATCACGTACACGCAATGCACTGACGGATATGAGTGGGATCCTGTGAGACAGCAATGCAAAGATATTGATGAATGTGACATTGTCCCAGACGCTTGTAAAGGTGGAATGAAGTGTGTCAACCACTATGGAGGATACCTCTGCCTTCCGAAAACAGCCCAGATTATTGTCAATAATGAACAGCCTCAGCAGGAAACACAACCAGCAGAAGGAACCTCAGGGGCAACCACCGGGGTTGTAGCTGCCAGCAGCATGGCAACCAGTGGAGTGTTGCCCGGGGGTGGTTTTGTGGCCAGTGCTGCTGCAGTCGCAGGCCCTGAAATGCAGACTGGCCGAAATAACTTTGTCATCCGGCGGAACCCAGCTGACCCTCAGCGCATTCCCTCCAACCCTTCCCACCGTATCCAGTGTGCAGCAGGCTACGAGCAAAGTGAACACAACGTGTGCCAAGACATAGACGAGTGCACTGCAGGGACGCACAACTGTAGAGCAGACCAAGTGTGCATCAATTTACGGGGATCCTTTGCATGTCAGTGCCCTCCTGGATATCAGAAGCGAGGGGAGCAGTGCGTAGACATAGATGAATGTACCATCCCTCCATATTGCCACCAAAGATGCGTGAATACACCAGGCTCATTTTATTGCCAGTGCAGTCCTGGGTTTCAATTGGCAGCAAACAACTATACCTGCGTAGATATAAATGAATGTGATGCCAGCAATCAATGTGCTCAGCAGTGCTACAACATTCTTGGTTCATTCATCTGTCAGTGCAATCAAGGATATGAGCTAAGCAGTGACAGGCTCAACTGTGAAGACATTGATGAATGCAGAACCTCAAGCTACCTGTGTCAATATCAATGTGTCAATGAACCTGGGAAATTCTCATGTATGTGCCCCCAGGGATACCAAGTGGTGAGAAGTAGAACATGTCAAGATATAAATGAGTGTGAGACCACAAATGAATGCCGGGAGGATGAAATGTGTTGGAATTATCATGGCGGCTTCCGTTGTTATCCACGAAATCCTTGTCAAGATCCCTACATTCTAACACCAGAGAACCGATGTGTTTGCCCAGTCTCAAATGCCATGTGCCGAGAACTGCCCCAGTCAATAGTCTACAAATACATGAGCATCCGATCTGATAGGTCTGTGCCATCAGACATCTTCCAGATACAGGCCACAACTATTTATGCCAACACCATCAATACTTTTCGGATTAAATCTGGAAATGAAAATGGAGAGTTCTACCTACGACAAACAAGTCCTGTAAGTGCAATGCTTGTGCTCGTGAAGTCATTATCAGGACCAAGAGAACATATCGTGGACCTGGAGATGCTGACAGTCAGCAGTATAGGGACCTTCCGCACAAGCTCTGTGTTAAGATTGACAATAATAGTGGGGCCATTTTCATTTTAGTCTTTTCTAAGAGTCAACCACAGGCATTTAAGTCAGCCAAAGAATATTGTTACCTTAAAGCACTATTTTATTTATAGATATATCTAGTGCATCTACATCTCTATACTGTACACTCACCCATAATTCAAACAATTACACCATGGTATAAAGTGGGCATTTAATATGTAAAGATTCAAAGTTTGTCTTTATTACTATATGTAAATTAGACATTAATCCACTAAACTGGTCTTCTTCAAGAGAGCTAAGTATACACTATCTGGTGAAACTTGGATTCTTTCCTATAAAAGTGGGACCAAGCAATGATGATCTTCTGTGGTGCTTAAGGAAACTTACTAGAGCTCCACTAACAGTCTCATAAGGAGGCAGCCATCATAACCATTGAATAGCATGCAAGGGTAAGAATGAGTTTTTAACTGCTTTGTAAGAAAATGGAAAAGGTCAATAAAGATATATTTCTTTAGAAAATGGGGATCTGCCATATTTGTGTTGGTTTTTATTTTCATATCCAGCCTAAAGGTGGTTGTTTATTATATAGTAATAAATCATTGCTGTACAATATGCTGGTTTCTGTAGGGTATTTTTAATTTTGTCAGAAATTTTAGATTGTGAATATTTTGTAAAAAACAGTAAGCAAAATTTTCCAGAATTCCCAAAATGAACCAGATATCCCCTAGAAAATTATACTATTGAGAAATCTATGGGGAGGATATGAGAAAATAAATTCCTTCTAAACCACATTGGAACTGACCTGAAGAAGCAAACTCGGAAAATATAATAACATCCCTGAATTCAGGACTTCCACAAGATGCAGAACAAAATGGATAAAAGGTATTTCACTGGAGAAGTTTTAATTTCTAAGTAAAATTTAAATCCTAACACTTCACTAATTTATAACTAAAATTTCTCATCTTCGTACTTGATGCTCACAGAGGAAGAAAATGATGATGGTTTTTATTCCTGGCATCCAGAGTGACAGTGAACTTAAGCAAATTACCCTCCTACCCAATTCTATGGAATATTTTATACGTCTCCTTGTTTAAAATGTCACTGCTTTACTTTGATGTATCATATTTTTAAATAAAAATAAATATTCCTTTAGAA