Transcript asmbl_73330

Sequence
Transcript Sequence for observation asmbl_73330 of TGE0057064:
GTTTGCATAAATTTTCTCAGCTTAAACAAAGTTAACATTGAATAGAGTAAGCTTACCATAAAGGGCTTAATAAATGCCATGCATGTCTACATTCGGTGTGGAAATTGAGCTAGTCAGGTTGATATTTAACATTGTAGGTTCTTTGTTAATTTATATGAAATAATGGTTATCATTTAACTCTTTAGGTTAGCTTTGTACATAGCATCTCACTTTGCACAACAACCCTGCAAGGCTGACCAACTGACTGAAGAGCAGATTGCAGAATTCAAAGAAGCTTTTTCACTATTTGACAAAGATGGTGATGGAACTATAACAACAAAGGAATTGGGAACTGTAATGAGATCTCTTGGGCAGAATCCCACAGAAGCAGAGTTACAGGACATGATTAATGAAGTAGATGCTGATGGTAATGGCACAATTGACTTCCCTGAATTTCTGACAATGATGGCAAGAAAAATGAAAGACACAGACAGTGAAGAAGAAATTAGAGAAGCATTCCGTGTGTTTGATAAGGATGGCAATGGCTATATTAGTGCTGCAGAACTTCGCCATGTGATGACAAACCTTGGAGAGAAGTTAACAGATGAAGAAGTTGATGAAATGATCAGGGAAGCAGATATTGATGGTGATGGTCAAGTAAACTATGAAGAGTTTGTACAAATGATGACAGCAAAGTGAAGACCTTGTACAGAATGTGTTAAATTTCTTGTACAAAATTGTTTATTTGCCTTTTCTTTGTTTGTAACTTATCTGTAAAAGGTTTCTCCCTACTGTCAAAAAAATATGCATGTATAGTAATTAGGACTTCATTCCTCCATGTTTTCTTCCCTTATCTTACTGTCATTGTCCTAAAACCTTATTTTAGAAAATTGATCAAGTAACATGTTGCATGTGGCTTACTCTGGATATATCTAAGCCCTTCTGCACATCTAAACTTAGATGGAGTTGGTCAAATGAGGGAACATCTGGGTTATGCCTTTTTTAAAGTAGTTTTCTTTAGGAACTGTCAGCATGTTGTTGTTGAAGTGTGGAGTTGTAACTCTGCGTGGACTATGGACAGTCAACAATATGTACTTAAAAGTTGCACTATTGCAAAACGGGTGTATTATCCAGGTACTCGTACACTATTTTTTTGTACTGCTGGTCCTGTACCAGAAACATTTTCTTTTATTGTTACTTGCTTTTTAAACTTTGTTTAGCCACTTAAAATCTGCTTATGGCACAATTTGCCTCAAAATCCATTCCAAGTTGTATATTTGTTTTCCAATAAAAAAATTACAATTTACCCAATGGTTGCTCTGCATCTGAGTCATTTAACTGTTGAAGTCTAATAATTTTGAAAATAAAATATGGCATTGGTTTCTGCTTGGTA