Transcript asmbl_73070

Sequence
Transcript Sequence for observation asmbl_73070 of TGE0057062:
CCTCGGACCACCGGACTGGCCTGGGGCGGGACGTGGGCGCGGGGGCGCGGCGTGCGGCACGCTGCAGGGCTGAAGCGGCGGCGGCGGTGGGGACTGCACGTAGCCCGGCGCTCGGCATGGCTCTCCTGGTGCTCGGTCTGGTGAGCTGTACCTTCTTTCTGGCAGTGAATGGTCTGTATTCCTCTAGTGATGATGTGATCGAATTAACTCCATCGAATTTCAACCGAGAAGTTATTCAGAGTGATAGTTTGTGGCTTGTAGAATTCTATGCTCCATGGTGTGGTCACTGTCAAAGATTAACACCAGAATGGAAGAAAGCAGCAACTGCATTAAAAGATGTTGTCAAAGTTGGTGCAGTTGATGCAGATAAGCATCATTCCCTAGGAGGTCAGTATGGTGTTCAGGGATTTCCTACCATTAAGATTTTTGGATCCAACAAAAACAGACCAGAAGATTACCAAGGTGGCAGAACTGGTGAAGCCATTGTAGATGCTGCGCTGAGTGCTCTGCGCCAGCTCGTGAAGGATCGCCTCGGGGGACGGAGCGGAGGATACAGTTCTGGAAAACAAGGCAGAAGTGATAGTTCAAGTAAGAAGGATGTGATTGAGCTGACAGACGACAGCTTTGATAAGAATGTTCTGGACAGTGAAGATGTTTGGATGGTTGAGTTCTATGCTCCTTGGTGTGGACACTGCAAAAACCTAGAGCCAGAGTGGGCTGCCGCAGCTTCAGAAGTAAAAGAGCAGACGAAAGGAAAAGTGAAACTGGCAGCTGTGGATGCTACAGTCAATCAGGTTCTGGCCTCCCGATACGGGATTAGAGGATTTCCTACAATCAAGATATTTCAGAAAGGCGAGTCTCCTGTGGATTATGACGGTGGGCGGACAAGATCCGACATCGTGTCCCGGGCCCTTGATTTGTTTTCTGATAACGCCCCACCTCCTGAGCTGCTTGAGATTATCAACGAGGACATTGCCAAGAGGACGTGTGAGGAGCACCAGCTCTGTGTTGTGGCTGTGCTGCCCCATATCCTTGATACTGGAGCTGCAGGCAGAAATTCTTATCTGGAAGTTCTTCTGAAGTTGGCAGACAAATACAAAAAGAAAATGTGGGGGTGGCTGTGGACAGAAGCTGGAGCCCAGTCTGAACTTGAGACCGCGTTGGGGATTGGAGGGTTTGGGTACCCCGCCATGGCCGCCATCAATGCACGCAAGATGAAATTTGCTCTGCTAAAAGGCTCCTTCAGTGAGCAAGGCATCAACGAGTTTCTCAGGGAGCTCTCTTTTGGGCGTGGCTCCACGGCACCTGTAGGAGGCGGGGCTTTCCCTACCATCGTTGAGAGAGAGCCTTGGGACGGCAGGGATGGCGAGCTTCCCGTGGAGGATGACATTGACCTCAGTGATGTGGAGCTTGATGACTTAGGGAAAGATGAGTTGTGAGAGCCACAACAGAGGCTTCAGACCATTTTCTTTTCTTGGGAGCCAGTGGATTTTTCCAGCAGTGAAGGGACATTCTCTACACTCAGATGACTCTACCAGTGGCCTTTTAACCAAGAAGTAGTACTTGATTGGTCATTTGAAAACACTGCAACAGTGAACTTTTGCATCTCAAGAAAACATTGAAAAATTCTATGAATTGTTGTAGCCGGTGAATTGAGTCGTATTCTGTCACATAATATTTTGAAGAAAACTTGGCTGTCGAAACATTTTTCTCTCTGACTGCTGCTTGAATGTTCTTGGAGGCTGTTTCTTATGTATGGGTTTTTTTTAATGTGATCCCTTCATTTGAATATTAATGGCTTTTTCCATTAAAGAATAAAATATTTTGGACAATGCCGATAAATGTATGAAGTTAGTATCCACATCATAAATTCAGAGTGATGTTTAGCAGTAAATCAATATTTTGAAGTGATACACAGATGTCTTTCCTCCCCACAAACTTTTTTAAACAAAAAACAAGACCTCTTTTCTTTAGATGGTGCCACCTATGCCCACCACAACAGAGATTTTACATGGAAACCGGGCTCAGTGAGAACTGATTTCCTGCCCAATATTTGTCTTTGGGCTGTCTCTAGTGACTAATTATTAAGGAATCTAGCTGGTTATACAGTTCAAGGCTTTCTATGTTGTTAATGAACCTCAAAATAGCCGTTAAGACATGAAATACAGCAGCAGGTTACCAATGCGAACAGGTAGTTCGCATTTATGTAAAACATTCAGAAAATGAAGTTTTGAATTTGTTGGAACATTCAAAGGACTTGAGAGCATTTTATTGTAACTTAAAAAAATAAATACAACTGTCACTAACTTTTGTGAGCAATTTCTCTGAAAAAGA