Transcript asmbl_72426

Sequence
Transcript Sequence for observation asmbl_72426 of TGE0056926:
GTTTTATGACGGGCCCGGTGCTGAAGGGCAGGGAACAACTTGATGGTGCTACTTTGAACTGCTTTTCTTTTCTCCTTTTTGCACAAAGAGTCTCATGTCTGATATTTAGACATGATGAGCTTTGTGCAAAAGGGGAGCTGGCTACTTCTCGCTCTGCTTCATCCCACTATTATTTTGGCACAACAGGAAGCTGTTGAAGGAGGATGTTCCCATCTTGGTCAGTCCTATGCGGATAGAGATGTCTGGAAGCCAGAACCATGCCAAATATGTGTCTGTGACTCAGGATCCGTTCTCTGCGATGACATAATATGTGACGATCAAGAATTAGACTGCCCCAACCCAGAAATTCCATTTGGAGAATGTTGTGCAGTTTGCCCACAGCCTCCAACTGCTCCTACTCGCCCTCCTAATGGTCAAGGACCTCAAGGCCCCAAGGGAGATCCAGGCCCTCCTGGTATTCCTGGGAGAAATGGTGACCCTGGTATTCCAGGACAACCAGGGTCCCCTGGTTCTCCTGGCCCCCCTGGAATCTGTGAATCATGCCCTACTGGTCCTCAGAACTATTCTCCCCAGTATGATTCATATGATGTCAAGTCTGGAGTAGCAGTAGGAGGACTCGCAGGCTATCCTGGACCAGCTGGCCCCCCAGGCCCTCCCGGTCCCCCTGGTACATCTGGTCATCCTGGTTCCCCTGGATCTCCAGGATACCAAGGACCCCCTGGTGAACCTGGGCAAGCTGGTCCTTCAGGCCCTCCAGGACCTCCTGGTGCTATAGGTCCATCTGGTCCTGCTGGAAAAGATGGAGAATCAGGTAGACCCGGACGACCTGGAGAGCGAGGATTGCCTGGACCTCCAGGTATCAAAGGTCCAGCTGGGATACCTGGATTCCCTGGTATGAAAGGACACAGAGGCTTCGATGGACGAAATGGAGAAAAGGGTGAAACAGGTGCTCCTGGATTAAAGGGTGAAAATGGTCTTCCAGGCGAAAATGGAGCTCCTGGACCCATGGGTCCAAGAGGGGCTCCTGGTGAGCGAGGACGGCCAGGACTTCCTGGGGCTGCAGGTGCTCGGGGTAATGACGGTGCTCGAGGCAGTGATGGTCAACCAGGCCCTCCTGGTCCTCCTGGAACTGCCGGATTCCCTGGATCCCCTGGTGCTAAGGGTGAAGTTGGACCTGCAGGGTCTCCTGGTTCAAATGGTGCCCCTGGACAAAGAGGAGAACCTGGACCTCAGGGACACGCTGGTGCTCAAGGTCCTCCTGGCCCTCCTGGGATTAATGGTAGTCCTGGTGGTAAAGGCGAAATGGGTCCCGCTGGCATTCCTGGAGCTCCTGGACTGATGGGAGCCCGGGGTCCTCCAGGACCAGCCGGTGCTAATGGTGCTCCTGGACTGCGAGGTGGTGCAGGTGAGCCTGGTAAGAATGGTGCCAAAGGAGAGCCCGGACCACGTGGTGAACGCGGTGAGGCTGGTATTCCAGGTGTTCCAGGAGCTAAAGGCGAAGATGGCAAGGATGGATCACCTGGAGAACCTGGTGCAAATGGGCTTCCAGGAGCTGCAGGAGAAAGGGGTGCCCCTGGGTTCCGAGGACCTGCTGGACCAAATGGCATCCCAGGAGAAAAGGGTCCTGCTGGAGAGCGTGGTGCTCCAGGCCCTGCAGGGCCCAGAGGAGCTGCTGGAGAACCTGGCAGAGATGGCGTCCCTGGAGGTCCAGGAATGAGGGGCATGCCCGGAAGTCCAGGAGGACCAGGAAGTGATGGGAAACCAGGGCCTCCCGGAAGTCAAGGAGAAAGTGGTCGACCAGGTCCTCCTGGGCCATCTGGTCCCCGAGGTCAGCCTGGTGTCATGGGCTTCCCCGGTCCTAAAGGAAATGATGGTGCTCCTGGTAAGAATGGAGAACGAGGTGGCCCTGGAGGACCTGGCCCTCAGGGTCCTCCTGGAAAGAATGGTGAAACTGGACCTCAGGGACCCCCAGGGCCTACTGGGCCTGGTGGTGACAAAGGAGACACAGGACCCCCTGGTCCACAAGGATTACAAGGCTTGCCTGGTACAGGTGGTCCTCCAGGAGAAAATGGAAAACCTGGGGAACCAGGTCCAAAGGGTGATGCCGGTGCACCTGGAGCTCCAGGAGGCAAGGGTGATGCTGGTGCCCCTGGTGAACGTGGACCTCCTGGATTGGCAGGGGCCCCAGGACTTAGAGGTGGAGCTGGTCCCCCTGGTCCCGAAGGAGGAAAGGGTGCTGCTGGTCCTCCTGGGCCACCTGGTGCTGCTGGTACTCCTGGTCTGCAAGGAATGCCTGGAGAAAGAGGAGGTCTTGGAAGTCCTGGTCCAAAGGGTGACAAGGGTGAACCAGGCGGTCCAGGTGCTGATGGTGTCCCAGGGAAAGATGGCCCAAGGGGTCCTACTGGTCCTATTGGTCCTCCTGGCCCAGCTGGCCAGCCTGGAGATAAGGGTGAAGGTGGTGCCCCCGGACTTCCAGGTATAGCTGGACCTCGTGGTAGCCCTGGTGAGAGAGGTGAAACTGGCCCTCCAGGACCTGCTGGTTTCCCTGGTGCTCCTGGACAGAATGGTGAACCTGGTGGTAAAGGAGAAAGAGGGGCTCCGGGTGAGAAAGGTGAAGGAGGCCCTCCTGGAGTTGCAGGACCCCCTGGAGGTTCTGGACCTGCTGGTCCTCCTGGTCCCCAAGGTGTCAAAGGTGAACGTGGCAGTCCTGGTGGACCTGGTGCTGCTGGCTTCCCTGGTGCTCGTGGTCTTCCTGGTCCTCCTGGTAGTAATGTAAGTAATTGTTAAAGTCTTTTCTCATCATACACTTCAGAAAGAGCATTCATGTATGTATAGGATGAGAAACTTACACATTGCTACTTATTTCTCTAGTAAGTCTCAAATAAAATTATTTGAAGTAAGTAAAAAAAGAAAGAAAAAATGCACTTTTTATTATAAATATTCAAATTTCAAACAATTATTTGTAGGGTAACCCAGGA