Transcript asmbl_71764

Sequence
Transcript Sequence for observation asmbl_71764 of TGE0057061:
GTTTTATATTGCTCTGGTATTCATGCCAAAGACACACCAGCCCTCAGTCACTGGGAGAAGAACCTCTCATACCCTCGGTGCTCCAGTCCCCAGCTCACTCAGCCACACACACCATGTGTGAAGAGGAGACCACCGCGCTCGTGTGTGACAATGGCTCTGGCCTGTGCAAGGCAGGCTTCGCAGGAGATGATGCCCCCCGGGCTGTCTTCCCCTCCATTGTGGGCCGCCCTCGCCACCAGGGTGTGATGGTGGGAATGGGCCAGAAAGACAGCTATGTGGGGGATGAGGCTCAGAGCAAGCGAGGGATCCTAACTCTCAAATACCCCATTGAACACGGCATCATCACCAACTGGGATGACATGGAGAAGATCTGGCACCACTCCTTCTACAATGAGCTGCGTGTAGCACCTGAAGAGCACCCCACCCTGCTCACAGAGGCTCCCCTAAATCCCAAGGCCAACAGGGAAAAGATGACCCAGATCATGTTTGAAACCTTCAATGTCCCTGCCATGTACGTCGCCATTCAAGCTGTGCTCTCCCTCTATGCCTCTGGCCGCACGACAGGCATCGTCCTGGATTCAGGTGATGGCGTCACCCACAATGTCCCCATCTATGAAGGCTATGCCCTGCCCCATGCCATCATGCGCCTGGACTTGGCTGGCCGTGACCTCACGGACTACCTCATGAAGATCCTCACAGAGAGAGGCTATTCCTTTGTGACCACAGCTGAGAGAGAAATTGTGCGAGACATCAAGGAGAAGCTGTGCTATGTGGCCCTGGATTTTGAGAATGAGATGGCCACAGCAGCTTCCTCTTCCTCCCTGGAGAAGAGCTATGAGCTGCCAGATGGGCAGGTTATCACCATTGGCAATGAGCGCTTCCGCTGCCCTGAGACCCTCTTCCAGCCTTCCTTTATTGGCATGGAGTCCGCTGGAATTCATGAGACAACCTACAATTCCATCATGAAGTGTGACATTGACATCCGTAAGGACTTATATGCCAACAATGTCCTCTCTGGGGGCACCACCATGTACCCTGGCATT