Transcript asmbl_71729

Sequence
Transcript Sequence for observation asmbl_71729 of TGE0057060:
GCGGTGGGAGGACTGCGGGGCTCTTGAGGCCAGCTGCAGAGCTTGTGGAGGCCATGGGGCGCGTCGTCGCGGAGCTCGTCTCCTCGCTGCTGGGGTTGTGGCTGTTGCTGTGCAGCTGCGGATGCCCCGAGGGCGCCGAGCTGCGTGCTCCGCCAGATAAAATCGCGATTATTGGAGCCGGAATTGGTGGCACTTCAGCAGCCTATTACCTGCGGCAGAAATTTGGGAAAGATGTGAAGATAGACCTGTTTGAAAGAGAAGAGGTCGGGGGCCGCCTGGCTACCATGATGGTGCAGGGGCAAGAATACGAGGCAGGAGGTTCTGTCATCCATCCTTTAAATCTGCACATGAAACGTTTTGTCAAAGACCTGGGTCTCTCTGCTGTTCAGGCCTCTGGTGGCCTACTGGGGATATATAATGGAGAGACTCTGGTATTTGAGGAGAGCAACTGGTTCATAATTAACGTGATTAAATTAGTTTGGCGCTATGGATTTCAATCCCTCCGTATGCACATGTGGGTAGAGGACGTGTTAGACAAGTTCATGAGGATCTACCGCTACCAGTCTCATGACTATGCCTTCAGTAGTGTCGAAAAATTACTTCATGCTCTAGGAGGAGATGACTTCCTTGGAATGCTTAATCGAACACTTCTTGAAACCTTGCAAAAGGCCGGCTTTTCTGAGAAGTTCCTCAATGAAATGATTGCTCCTGTTATGAGGGTCAATTATGGCCAAAGCACGGACATCAATGCCTTTGTGGGGGCGGTGTCACTGTCCTGTTCTGATTCTGGCCTTTGGGCAGTAGAAGGTGGCAATAAACTTGTTTGCTCAGGGCTTCTGCAGGCATCCAAAAGCAATCTTATATCTGGCTCAGTAATGTACATCGAGGAGAAAACAAAGACCAAGTACACAGGAAATCCAACAAAGATGTATGAAGTGGTCTACCAAATTGGAACTGAGACTCGTTCAGACTTCTATGACATCGTCTTGGTGGCCACTCCGTTGAATCGAAAAATGTCGAATATTACTTTTCTCAACTTTGATCCTCCAATTGAGGAATTCCATCAATATTATCAACATATAGTGACAACTTTAGTTAAGGGGGAATTGAATACATCTATCTTTAGCTCTAGACCCATAGATAAATTTGGCCTTAATACAGTTTTAACCACTGATAATTCAGATTTGTTCATTAACAGTATTGGGATTGTGCCCTCTGTGAGAGAAAAGGAAGATCCTGAGCCATCAACAGATGGAACATATGTTTGGAAGATCTTTTCCCAAGAAACTCTTACTAAAGCACAAATTTTAAAGCTCTTTCTGTCCTATGATTATGCTGTGAAGAAGCCATGGCTTGCATATCCTCACTATAAGCCCCCGGAGAAATGCCCCTCTATCATTCTCCATGATCGACTTTATTACCTCAATGGCATAGAGTGTGCAGCAAGTGCCATGGAGATGAGTGCCATTGCAGCCCACAACGCTGCACTCCTTGCCTATCACCGCTGGAACGGGCACACAGACATGATTGATCAGGATGGCTTATATGAGAAACTTAAAACTGAACTATGAAGTGACACACTCCTTTTTCCCCTCCTAGTTCCAAATGACTATCAGTGGCAAAAAAGAACAAAATCTGAGCAGAGATGATTTTGAACCAGATATTTTGCCATTATCATTGTTTAATAAAAGTAATCCCTGCTGGTCATAGGAAAACACACGGTTCTAATTAAGTGTGAAGGTATAGCTATTGCACTTATGCCATCTCCAAAATTTCTTAAGTATTCTTTCACTATCCATTAGGAGTTTTTCTTAAACTTGTCTGATAATAAGAATCACCTGGAGTTAGGAGGTGGTGGTTGCAGTGAGCCAATCTCACCATTGCACTTCAGCCTGAGCAACACGAGCAAAACTCCGTCTCAAAAGTAAATAAAAATAATCACCTGGAGTTTGTTAAACCATATGGATTCTCAAGCTCCTCTCTTGAAGATTCTGATTCAGTAGGTCTGGGAGTGGCGCGCTGGATTTTGATCAAAATTGTAGAGCATTTTAAGGTGAGTACCTGAGGGAGAACTTAAAGACATCTTAGTTGGGGAGTAGTCCTTTTGAATTTTACAGCTAGATATAATCTTCAGTCAGATAAAATTTATGGGAGCTGGTGTCTTATGCCTGACTCTTAGTAATTTCATACCGGTTTGAAGTACGTGTGCCCATGCCTAAAGCCTTGACTTTCAGAATGTTGTCTTTTGATTCTTCTGTCTTGATTTGATTAGGGGTGAAATTTAGAAGTCTTAGTAATGTAACTTGAAGATGTTAAACAAAAATCTCAAGTAAAATGAAAAGCAAATATGGGCTACTGAATTAAGAAACTGGCATTCTAGTATTAAATCCTCACTTCAGGAGCTTTTAAAAATACTGAGACCCCCCCATAACCAGAGATTCAGATTCAAAGACTGAGGATAGGACCTTAGCATTGTAGCTATTTAAAGTTTCTAATGTGCACCCAGGGTTGGGAATCACCAATGTGGGTGTGAAAATGCCTACAAAGGGTTTTAGTGCCTTAGAAGTCCTAAGAAGCCCAATCTGTATCAAAGCAGATCCATTTTGCAAGGATCTTTCTTTTAGAACTTTCTCAGTTCTCTTAGTAAGAACTTTAGAAGTAATCTTGATAATAAGCACAGACAGCCTAACAGCAGAGGCAACTTAAATAACTCCTGAGCAGTTGGCACTAGAACAGAATACTTGGAATGACACCAAAGTTAACCAAGTCCAGCATATGTCCAAAGAGTTAAGTGTTTCATTTACTGTAGCATTCTGGGTGAGAAATTGGTTGCTGAAATCTTAAGACAGTGGTCTCAACCTTGGCTGCACATTGGAATCACCTGTAGGGTTTTAAAGCATCCAAATGGTAATTAACAGGCAGCAAAACTTCAGAACTAGTTCTGCATCTACTGTGCAAAGATCATGATTAACTGTCAAGACACTGGTAGAACAGAACAAGCAAAAGATTAAGAGTTCAAAAGTAAATGCAACCAATTTAACATGTAGTGTTATTAAAAAATTACAAAGGCCTAGACCAGCCTGGGCAACATGGTGAAACCCCATCTCTACAAAAA