Transcript asmbl_71677

Sequence
Transcript Sequence for observation asmbl_71677 of TGE0001245:
GGGAGGTGTTTAGGAGAAAGTAGGGGCTGTGGGTGTCGGGAGCCGGCTGACGGGTGGACAAGGGGGGGTTAGCAGCTGGGCTGCGACCGTTAGGGAGGGGCTCAAGGTGTGCATGTGTGAGGGAAGAGAGAGAGAGAGAAGGGCGCCTCAGAGGTGACTTTCAGCCTGCGAGCCTTCTTCCCGGGGCGCCATAAACGCCCCCAATTTCCCAGCTGCTAAAGGAAGAGGAAGGTACCTGTGCGTGCACGCAGACGGGAAGGGCTGGGGAAGCGGGAGGACTGAGAAAAGCCGGATCTTAGCAAAGCAATGTCTCAAGATGGTGCTTCTCAGTTCCAAGAAGTCATTCGGCAAGAGCTAGAATTATCTGTGAAGAAGGAACTAGAAAAAATACTCACCACAGCATCATCACATGAATTTGAGCACACCAAAAAAGACCTGGATGGATTTCGGAAGCTATTTCATAGATTTTTGCAAGAAAAGGGGCCTTCTGTGGATTGGGGAAAAATCCAGAGACCCCCTGAAGATTCGATTCAACCCTATGAAAAGATAAAGGCCAGGGGCTTGCCTGATAATATATCTTCCGTGTTGAACAAACTAGTGGTGGTGAAACTCAATGGTGGTTTGGGAACCAGCATGGGCTGCAAAGGCCCTAAAAGTCTGATTGGTGTGAGGAATGAGAATACCTTTCTGGATCTGACTGTTCAGCAAATTGAACATTTGAATAAAACCTACAATACAGATGTTCCTCTTGTTTTAATGAACTCTTTTAACACGGATGAAGATACCAAAAAAATACTACAGAAGTACAATCATTGTCGTGTGAAAATCTACACTTTCAATCAAAGCAGGTACCCGAGGATTAATAAAGAATCTTTACTTCCTGTAGCAAAGGACGTGTCTTACTCAGGGGAAAATACAGAAGCTTGGTACCCTCCAGGTCATGGTGATATTTACGCCAGTTTCTACAACTCTGGATTGCTTGATACCTTTATAGGAGAAGGCAAAGAGTATATTTTTGTGTCTAACATAGATAATCTGGGTGCCACAGTGGATCTGTATATTCTTAATCATCTAATGAACCCACCCAATGGAAAACGCTGTGAATTTGTCATGGAAGTCACAAATAAAACACGTGCAGATGTAAAGGGCGGGACACTCACTCAATATGAAGGCAAACTGAGACTGGTGGAAATTGCTCAAGTGCCAAAAGCACATGTAGACGAGTTCAAGTCTGTATCAAAGTTCAAAATATTTAATACAAACAACCTATGGATTTCTCTTGCAGCAGTTAAAAGACTGCAGGAGCAAAATGCCATTGACATGGAAATCATTGTGAATGCAAAGACTTTGGATGGAGGCCTGAATGTCATTCAATTAGAAACTGCAGTAGGGGCTGCCATCAAAAGTTTTGAGAATTCTCTAGGTATTAATGTGCCAAGGAGCCGTTTTCTGCCTGTCAAAACCACATCAGATCTCTTGCTGGTGATGTCAAACCTCTATAGTCTTAATGCAGGATCTCTGACAATGAGTGAAAAGCGGGAATTTCCTACAGTGCCCTTGGTTAAATTAGGCAGTTCTTTTACGAAGGTTCAAGATTATCTAAGAAGATTTGAAAGTATACCAGATATGCTTGAATTGGATCACCTCACAGTTTCAGGAGATGTGACATTTGGAAAAAATGTTTCATTAAAGGGAACGGTTATCATCATTGCAAATCATGGTGACAGAATTGATATCCCACCTGGAGCAGTATTAGAGAACAAGATTGTGTCTGGAAACCTTCGCATCTTGGACCACTGAAATGAAAAATACTGTGGACACTTAAATAATGGGCTAGTTTCTTACAATGAAATGTTCTCTAGGATTCTAAAATAGGCAGGTACTTTACTATGTTACTGTACCCTGCAGTGTTGATTTTTAAAATAGAGTTTTCTGCAGTATGCTTTTAGTCTAAGAAAAGCACAGATGGAGCAATACTTTCCTTCTTTGAAGAGAATCCCAAAAGTTAGTTCATCTTAAAGTGCAATATTGTTTAATCTTAAAACTGGGCAACTTTGGAAGAACTTTTAACAGAAGCCTCAATGATGATCACTTTGAATTGCTTGTGATTTCAAAAATAAAGCAGTGAAGCAATACTTGTGTACACTGGTACTTTATAATGCTAACTATAAACTGGTTTATTGTTGTTAGACAGTTACTATATTAGTTGGAAGATTTGCCCTTTAAGTACACAC