Transcript asmbl_71673

Sequence
Transcript Sequence for observation asmbl_71673 of TGE0001245:
GGGAGGTGTTTAGGAGAAAGTAGGGGCTGTGGGTGTCGGGAGCCGGCTGACGGGTGGACAAGGGGGGGTTAGCAGCTGGGCTGCGACCGTTAGGGAGGGGCTCAAGGTGTGCATGTGTGAGGGAAGAGAGAGAGAGAGAAGGGCGCCTCAGAGGTGACTTTCAGCCTGCGAGCCTTCTTCCCGGGGCGCCATAAACGCCCCCAATTTCCCAGCTGCTAAAGGAAGAGGAAGATCTTAGCAAAGCAATGTCTCAAGATGGTGCTTCTCAGTTCCAAGAAGTCATTCGGCAAGAGCTAGAATTATCTGTGAAGAAGGAACTAGAAAAAATACTCACCACAGCATCATCACATGAATTTGAGCACACCAAAAAAGACCTGGATGGATTTCGGAAGCTATTTCATAGATTTTTGCAAGAAAAGGGGCCTTCTGTGGATTGGGGAAAAATCCAGAGACCCCCTGAAGATTCGATTCAACCCTATGAAAAGATAAAGGCCAGGGGCTTGCCTGATAATATATCTTCCGTGTTGAACAAACTAGTGGTGGTGAAACTCAATGGTGGTTTGGGAACCAGCATGGGCTGCAAAGGCCCTAAAAGTCTGATTGGTGTGAGGAATGAGAATACCTTTCTGGATCTGACTGTTCAGCAAATTGAACATTTGAATAAAACCTACAATACAGATGTTCCTCTTGTTTTAATGAACTCTTTTAACACGGATGAAGATACCAAAAAAATACTACAGAAGTACAATCATTGTCGTGTGAAAATCTACACTTTCAATCAAAGCAGGTACCCGAGGATTAATAAAGAATCTTTACTTCCTGTAGCAAAGGACGTGTCTTACTCAGGGGAAAATACAGAAGCTTGGTACCCTCCAGGTCATGGTGATATTTACGCCAGTTTCTACAACTCTGGATTGCTTGATACCTTTATAGGAGAAGGCAAAGAGTATATTTTTGTGTCTAACATAGATAATCTGGGTGCCACAGTGGATCTGTATATTCTTAATCATCTAATGAACCCACCCAATGGAAAACGCTGTGAATTTGTCATGGAAGTCACAAATAAAACACGTGCAGATGTAAAGGGCGGGACACTCACTCAATATGAAGGCAAACTGAGACTGGTGGAAATTGCTCAAGTGCCAAAAGCACATGTAGACGAGTTCAAGTCTGTATCAAAGTTCAAAATATTTAATACAAACAACCTATGGATTTCTCTTGCAGCAGTTAAAAGACTGCAGGAGCAAAATGCCATTGACATGGAAATCATTGTGAATGCAAAGACTTTGGATGGAGGCCTGAATGTCATTCAATTAGAAACTGCAGTAGGGGCTGCCATCAAAAGTTTTGAGAATTCTCTAGGTATTAATGTGCCAAGGAGCCGTTTTCTGCCTGTCAAAACCACATCAGATCTCTTGCTGGTGATGTCAAACCTCTATAGTCTTAATGCAGGATCTCTGACAATGAGTGAAAAGCGGGAATTTCCTACAGTGCCCTTGGTTAAATTAGGCAGTTCTTTTACGAAGGTTCAAGATTATCTAAGAAGATTTGAAAGTATACCAGATATGCTTGAATTGGATCACCTCACAGTTTCAGGAGATGTGACATTTGGAAAAAATGTTTCATTAAAGGGAACGGTTATCATCATTGCAAATCATGGTGACAGAATTGATATCCCACCTGGAGCAGTATTAGAGAACAAGATTGTGTCTGGAAACCTTCGCATCTTGGACCACTGAAATGAAAAATACTGTGGACACTTAAATAATGGGCTAGTTTCTTACAATGAAATGTTCTCTAGGATTCTAAAATAGGCAGGTACTTTACTATGTTACTGTACCCTGCAGTGTTGATTTTTAAAATAGAGTTTTCTGCAGTATGCTTTTAGTCTAAGAAAAGCACAGATGGAGCAATACTTTCCTTCTTTGAAGAGAATCCCAAAAGTTAGTTCATCTTAAAGTGCAATATTGTTTAATCTTAAAACTGGGCAACTTTGGAAGAACTTTTAACAGAAGCCTCAATGATGATCACTTTGAATTGCTTGTGATTTCAAAAATAAAGCAGTGAAGCAATACTTGTGTACACTGGTACTTTATAATGCTAACTATAAACTGGTTTATTGTTGTTAGACAGTTACTATATTAGTTGGAAGATTTGCCCTTTAAGTACACAC