Transcript asmbl_71509

Sequence
Transcript Sequence for observation asmbl_71509 of TGE0057058:
TTCAAATGTGGTTTTGGAGTGCATCCCAGAGTTCTGTTTGCTAAGCTTCCTACTCCTGTTTCAGAGACACCACTGAATACAGAGCAGCGAGCACTGAAGGCTTCCCTCTTTCCTTAAACCTGTCGGGTTGTGGGCTCTCTCTTTTCCCCTCTTGCTCCTTTCTTTTCTTTTTTTCTGTTTTTTTAAACCTTCCAAGGCAAGTTCATGGATACTAAGCTGATGTGTTTGTTGTTCTTTTTCTCCCTGCCTCCGCTCCTAGTGAGTAACCACACTGGCCGCATCAAGGTGGTCTTTACTCCGAGCATCTGTAAAGTGACCTGCACCAAGGGCAGCTGTCAGAACAGCTGTGAGAAGGGGAACACCACCACTCTCATTAGTGAGAATGGTCATGCTGCCGACACCCTGACGGCCACGAACTTCCGAGTGGTAATTTGCCATCTTCCATGTATGAATGGTGGCCAGTGCAGTTCAAGGGACAAATGTCAGTGCCCTCCAAATTTCACAGGAAAACTTTGTCAGATCCCAGTCCATGGTGCCAGCGTGCCTAAACTTTATCAGCATTCCCAGCAGCCAGGCAAGGCGTTGGGGACGCATGTCATCCATTCAACACATACCTTGCCTCTGACCGTGACTAGCCAGCAAGGAGTCAAAGTGAAATTTCCTCCTAACATAGTCAATATCCATGTGAAACATCCTCCTGAAGCTTCCGTCCAGATACATCAGGTTTCAAGAATTGATGGCCCAACAGGCCAGAAGACAAAAGAAGCTCAACCAGGCCAATCCCAAGTCTCGTACCAAGGGCTTCCTGTCCAGAAGACCCAGACCATACATTCCACATACTCCCACCAGCAGGTCATTCCTCACGTCTACCCCGTGGCTGCTAAGACACAGCTTGGCCGGTGCTTCCAGGAAACCATTGGGTCACAGTGTGGCAAAGCGCTCCCTGGCCTTTCAAAGCAAGAGGACTGCTGTGGAACTGTGGGTACCTCCTGGGGCTTTAACAAATGCCAGAAATGCCCCAAGAAACCATCTTATCATGGATACAACCAAATGATGGAATGCCTACCGGGTTATAAGCGGGTTAACAACACCTTTTGCCAAGATATTAATGAATGTCAGCTACAAGGTGTATGCCCTAATGGTGAGTGTTTGAATACCATGGGCAGCTATCGATGTACCTGCAAAATAGGATTTGGGCCGGATCCTACCTTTTCAAGTTGTGTTCCTGATCCCCCTGTGATCTCGGAAGAGAAAGGGCCCTGTTACCGACTTGTCAGTTCTGGAAGACAGTGTATGCACCCTCTGTCTGTTCACCTCACCAAGCAGCTCTGCTGTTGTAGTGTGGGCAAGGCCTGGGGCCCACACTGTGAGAAATGTCCCCTTCCAGGCACAGCTGCTTTTAAGGAAATCTGTCCTGGTGGAATGGGTTATACGGTTTCTGGCGTTCATAGACGCAGGCCAATCCATCACCATGTAGGTAAAGGACCTGTATTTGTCAAGCCAAAGAACACTCAACCTGTTGCTAAAAGTACTCATCCTCCACCTCTCCCAGCCAAGGAAGAGCCAGTGGAGGCCCTGACCTTCTCCCGGGAACACGGGCCAGGAGTGGCGGAGCCAGAAGTGGCAACTGCACCCCCTGAAAAGGAAATACCTTCATTGGATCAAGAGAAAACCAAACTTGAGCCTGGTCAACCCCAGCTGTCTCCAGGCATTTCCACTATTCATCTGCATCCACAGTTTCCAGTAGTGATTGAAAAAACATCACCTCCTGTGCCTGTTGAAGTAGCTCCTGAAGCTTCTACGTCTAGTGCCAGCCAAGTGATTGCTCCTACTCAAGTGACAGAAATCAATGAATGTACTGTGAACCCTGATATCTGTGGAGCAGGACACTGCATTAACCTACCAGTGAGATATACCTGTATATGCTACGAGGGCTACAGGTTCAGTGAACAACAGAGGAAATGTGTGGATATTGATGAGTGTACTCAGGTCCAACACCTCTGCTCCCAGGGCCGCTGTGAAAACACCGAGGGAAGTTTCTTGTGCATTTGCCCAGCAGGATTTATGGCCAGTGAGGAGGGTACTAACTGCATAGATGTTGACGAATGCCTGAGGCCGGACGTCTGTGGGGAGGGGCACTGTGTCAATACTGTGGGGGCCTTCCGGTGTGAATACTGTGACAGCGGGTACCGCATGACTCAGAGAGGCCGTTGTGAGGATATTGATGAATGTTTGAATCCAAGCACTTGTCCAGATGAGCAGTGTGTGAATTCTCCTGGATCTTACCAGTGCGTTCCCTGCACAGAAGGATTCCGAGGCTGGAATGGACAGTGCCTTGATGTGGACGAGTGCCTGGAACCAAACGTCTGCGCAAATGGTGATTGTTCCAACCTTGAAGGCTCCTACATGTGTTCATGCCACAAAGGCTATACCCGGACTCCGGACCACAAGCACTGTAGAGATATTGATGAATGTCAGCAAGGGAATCTATGTGTAAACGGGCAGTGCAAAAATACCGAGGGCTCCTTCAGGTGCACCTGTGGACAGGGGTACCAGCTGTCGGCAGCTAAAGACCAGTGTGAAGACATTGATGAATGCCAGCACCGTCATCTCTGTGCTCATGGGCAGTGCAGGAACACTGAGGGCTCTTTTCAATGTGTGTGTGACCAGGGTTACAGAGCATCTGGGCTTGGAGACCACTGTGAAGATATCAATGAATGCTTGGAGGACAAGAGTGTTTGCCAGAGAGGAGACTGCATTAATACTGCAGGGTCCTATGATTGTACTTGTCCGGATGGATTTCAGCTAGATGACAATAAAACATGTCAAGATATTAATGAATGTGAACATCCAGGGCTCTGTGGTCCGCAAGGGGAGTGCCTAAACACAGAGGGTTCTTTCCATTGTGTCTGCCAGCAGGGTTTCTCAATCTCTGCAGATGGCCGTACGTGTGAAGATATTGATGAATGTGTAAACAACACTGTTTGTGACAGTCACGGGTTTTGTGACAATACAGCTGGCTCCTTCCGCTGCCTCTGTTATCAGGGCTTTCAAGCCCCACAGGATGGGCAAGGGTGTGTGGATGTGAATGAATGTGAACTGCTCAGTGGGGTGTGTGGTGAAGCCTTCTGTGAAAACGTGGAAGGGTCCTTCCTGTGCGTGTGTGCTGATGAAAACCAAGAGTACAGCCCCATGACTGGGCAGTGCCGCTCCCGGACCTCCACAGATTTAGATGTAGATGTAGATCAACCCAAAGAAGAAAAGAAAGAATGCTACTATAATCTCAATGACGCCAGTCTCTGTGATAATGTGTTGGCCCCCAATGTCACGAAACAAGAATGCTGCTGTACATCAGGCGTGGGATGGGGAGATAACTGCGAAATCTTCCCCTGCCCGGTCTTGGGAACTGCTGAGTTCACTGAAATGTGTCCCAAAGGGAAAGGTTTTGTGCCTGCTGGAGAATCATCTTCTGAAGCTGGTGGTGAGAACTATAAAGATGCAGATGAATGCCTACTTTTTGGACAAGAAATCTGCAAAAATGGTTTCTGTTTGAACACTCGGCCTGGGTATGAATGCTACTGTAAGCAAGGGACGTACTATGATCCTGTGAAACTGCAGTGCTTTGATATGGATGAATGTCAAGACCCCAGTAGTTGTATTGATGGCCAGTGTGTTAATACAGAGGGCTCTTACAACTGCTTCTGTACTCACCCCATGGTCCTGGATGCGTCAGAAAAAAGATGTATACGACCGGCTGAGTCAAACGAACAAATAGAAGAAACTGATGTCTACCAAGATTTGTGCTGGGAACATCTGAGTGATGAATACGTGTGTAGCCGGCCTCTTGTGGGCAAGCAGACAACGTACACTGAGTGCTGCTGTCTGTATGGAGAGGCCTGGGGCATGCAGTGTGCCCTCTGCCCCCTGAAGGATTCAGATGACTATGCTCAGCTGTGTAACATCCCCGTGACGGGACGCCGGCAGCCATATGGACGGGACGCCTTGGTTGACTTCAGTGAACAGTATACTCCAGAAGCCGATCCCTACTTCATCCAAGACCGTTTTCTAAATAGCTTTGAGGAGTTACAGGCTGAGGAATGCGGCATCCTCAATGGATGTGAAAATGGTCGCTGTGTGAGGGTCCAGGAAGGTTACACCTGCGATTGCTTTGATGGGTATCACTTGGATACGGCCAAGATGACCTGTGTCGATGTAAATGAATGCGATGAGTTGAACAACCGGATGTCTCTCTGCAAGAATGCCAAGTGCATTAACACCGATGGTTCCTACAAGTGTTTGTGTCTGCCAGGCTACGTGCCTTCTGACAAGCCAAACTACTGCACTCCGTTGAATACCGCCTTGAATTTAGAGAAAGACAGTGACCTGGAGTGAAACAGAATCTACATAACCTAAGCCCATATACTCTGCACTGTGTAAAGGAAAAGGGAGAAATGTATTATACTTGAGACATTGCACCTACCCCGGAAGGCTGGAAATACAGAAACAGCATGGAATTGCAAGTCCTCTGAAGACAATGAGAGGATTTAGGATGAGCCCGATAGGTGTGGCAGACCAAATGGACATTTCTCTAAAAAACCAGTATATATAGTCTGTTCATATGTAAAATTCAATGGAAGAGAGGTGGAACAGTGCTGTTATTTTAAACAGAAGGTTGTATTATTATGTTGTTTTGTTTTTTTACTATTGCTTGATTAAATTTGGCATTTAAATAGTGGTGGAAATATTTTATATAATTTTCATTTTTTGGTTGTGCAGTTCCTTGGCTACTGTTTTTCTTTTACTTCAGTTTTTTAAAAATCTCAAATGAAAAAGTCTTCGATACAATATTGTTAAGCTGTATTATAAGTATTGTTACACAGGGTTATGCAATTCCCGGCCTGGAGCATTTTTGAAATTCAAATTGTCTGTCCTGTGGAGCAGGCAGTGATTTTGTTCCAAAACTTTGTATACACATTTGGAGAAAAGTACTTTATATTTTCAGTGTTTTGTCTGATTTTAATGTCCGTTCTTAGCCAAGCTGCTAGCAGGTGTTAATTGGATCCCTTTCCTTCACTGAAATGGAAGAGTTTATAAGCTTACGTTAGTATTGTAATATGTAAAGTAAGCCCAACAAAAATTTTTAAAAATTTGATGATCCCCAATATATCTACCATTGTATGTTAAATAAATCACCATTTTTGTAGAAAAAATTCTACCTGAGAGTAATTGTCAATGAGTACATGTGTATAAGTTGTATCCCACTCTCCCCACTTTTATCTTTTCCAGTGGTCTTCTGTTAATGTAGTGTCTT