Transcript asmbl_71508

Sequence
Transcript Sequence for observation asmbl_71508 of TGE0057057:
TTCAAATGTGGTTTTGGAGTGCATCCCAGAGTTCTGTTTGCTAAGCTTCCTACTCCTGTTTCAGAGACACCACTGAATACAGAGCAGCGAGCACTGAAGGCTTCCCTCTTTCCTTAAACCTGTCGGGTTGTGGGCTCTCTCTTTTCCCCTCTTGCTCCTTTCTTTTCTTTTTTTCTGTTTTTTTAAACCTTCCAAGGCAAGTTCATGGATACTAAGCTGATGTGTTTGTTGTTCTTTTTCTCCCTGCCTCCGCTCCTAGTGAGTAACCACACTGGCCGCATCAAGGTGGTCTTTACTCCGAGCATCTGTAAAGTGACCTGCACCAAGGGCAGCTGTCAGAACAGCTGTGAGAAGGGGAACACCACCACTCTCATTAGTGAGAATGGTCATGCTGCCGACACCCTGACGGCCACGAACTTCCGAGTGGTAATTTGCCATCTTCCATGTATGAATGGTGGCCAGTGCAGTTCAAGGGACAAATGTCAGTGCCCTCCAAATTTCACAGGAAAACTTTGTCAGATCCCAGTCCATGGTGCCAGCGTGCCTAAACTTTATCAGCATTCCCAGCAGCCAGGCAAGGCGTTGGGGACGCATGTCATCCATTCAACACATACCTTGCCTCTGACCGTGACTAGCCAGCAAGGAGTCAAAGTGAAATTTCCTCCTAACATAGTCAATATCCATGTGAAACATCCTCCTGAAGCTTCCGTCCAGATACATCAGGTTTCAAGAATTGATGGCCCAACAGGCCAGAAGACAAAAGAAGCTCAACCAGGCCAATCCCAAGTCTCGTACCAAGGGCTTCCTGTCCAGAAGACCCAGACCATACATTCCACATACTCCCACCAGCAGGTCATTCCTCACGTCTACCCCGTGGCTGCTAAGACACAGCTTGGCCGGTGCTTCCAGGAAACCATTGGGTCACAGTGTGGCAAAGCGCTCCCTGGCCTTTCAAAGCAAGAGGACTGCTGTGGAACTGTGGGTACCTCCTGGGGCTTTAACAAATGCCAGAAATGCCCCAAGAAACCATCTTATCATGGATACAACCAAATGATGGAATGCCTACCGGGTTATAAGCGGGTTAACAACACCTTTTGCCAAGATATTAATGAATGTCAGCTACAAGGTGTATGCCCTAATGGTGAGTGTTTGAATACCATGGGCAGCTATCGATGTACCTGCAAAATAGGATTTGGGCCGGATCCTACCTTTTCAAGTTGTGTTCCTGATCCCCCTGTGATCTCGGAAGAGAAAGGGCCCTGTTACCGACTTGTCAGTTCTGGAAGACAGTGTATGCACCCTCTGTCTGTTCACCTCACCAAGCAGCTCTGCTGTTGTAGTGTGGGCAAGGCCTGGGGCCCACACTGTGAGAAATGTCCCCTTCCAGGCACAGCCAAGGAAGAGCCAGTGGAGGCCCTGACCTTCTCCCGGGAACACGGGCCAGGAGTGGCGGAGCCAGAAGTGGCAACTGCACCCCCTGAAAAGGAAATACCTTCATTGGATCAAGAGAAAACCAAACTTGAGCCTGGTCAACCCCAGCTGTCTCCAGGCATTTCCACTATTCATCTGCATCCACAGTTTCCAGTAGTGATTGAAAAAACATCACCTCCTGTGCCTGTTGAAGTAGCTCCTGAAGCTTCTACGTCTAGTGCCAGCCAAGTGATTGCTCCTACTCAAGTGACAGAAATCAATGAATGTACTGTGAACCCTGATATCTGTGGAGCAGGACACTGCATTAACCTACCAGTGAGATATACCTGTATATGCTACGAGGGCTACAGGTTCAGTGAACAACAGAGGAAATGTGTGGATATTGATGAGTGTACTCAGGTCCAACACCTCTGCTCCCAGGGCCGCTGTGAAAACACCGAGGGAAGTTTCTTGTGCATTTGCCCAGCAGGATTTATGGCCAGTGAGGAGGGTACTAACTGCATAGATGTTGACGAATGCCTGAGGCCGGACGTCTGTGGGGAGGGGCACTGTGTCAATACTGTGGGGGCCTTCCGGTGTGAATACTGTGACAGCGGGTACCGCATGACTCAGAGAGGCCGTTGTGAGGATATTGATGAATGTTTGAATCCAAGCACTTGTCCAGATGAGCAGTGTGTGAATTCTCCTGGATCTTACCAGTGCGTTCCCTGCACAGAAGGATTCCGAGGCTGGAATGGACAGTGCCTTGATGTGGACGAGTGCCTGGAACCAAACGTCTGCGCAAATGGTGATTGTTCCAACCTTGAAGGCTCCTACATGTGTTCATGCCACAAAGGCTATACCCGGACTCCGGACCACAAGCACTGTAGAGATATTGATGAATGTCAGCAAGGGAATCTATGTGTAAACGGGCAGTGCAAAAATACCGAGGGCTCCTTCAGGTGCACCTGTGGACAGGGGTACCAGCTGTCGGCAGCTAAAGACCAGTGTGAAGACATTGATGAATGCCAGCACCGTCATCTCTGTGCTCATGGGCAGTGCAGGAACACTGAGGGCTCTTTTCAATGTGTGTGTGACCAGGGTTACAGAGCATCTGGGCTTGGAGACCACTGTGAAGATATCAATGAATGCTTGGAGGACAAGAGTGTTTGCCAGAGAGGAGACTGCATTAATACTGCAGGGTCCTATGATTGTACTTGTCCGGATGGATTTCAGCTAGATGACAATAAAACATGTCAAGATATTAATGAATGTGAACATCCAGGGCTCTGTGGTCCGCAAGGGGAGTGCCTAAACACAGAGGGTTCTTTCCATTGTGTCTGCCAGCAGGGTTTCTCAATCTCTGCAGATGGCCGTACGTGTGAAGATATTGATGAATGTGTAAACAACACTGTTTGTGACAGTCACGGGTTTTGTGACAATACAGCTGGCTCCTTCCGCTGCCTCTGTTATCAGGGCTTTCAAGCCCCACAGGATGGGCAAGGGTGTGTGGATGTGAATGAATGTGAACTGCTCAGTGGGGTGTGTGGTGAAGCCTTCTGTGAAAACGTGGAAGGGTCCTTCCTGTGCGTGTGTGCTGATGAAAACCAAGAGTACAGCCCCATGACTGGGCAGTGCCGCTCCCGGACCTCCACAGATTTAGATGTAGATGTAGATCAACCCAAAGAAGAAAAGAAAGAATGCTACTATAATCTCAATGACGCCAGTCTCTGTGATAATGTGTTGGCCCCCAATGTCACGAAACAAGAATGCTGCTGTACATCAGGCGTGGGATGGGGAGATAACTGCGAAATCTTCCCCTGCCCGGTCTTGGGAACTGCTGAGTTCACTGAAATGTGTCCCAAAGGGAAAGGTTTTGTGCCTGCTGGAGAATCATCTTCTGAAGCTGGTGGTGAGAACTATAAAGATGCAGATGAATGCCTACTTTTTGGACAAGAAATCTGCAAAAATGGTTTCTGTTTGAACACTCGGCCTGGGTATGAATGCTACTGTAAGCAAGGGACGTACTATGATCCTGTGAAACTGCAGTGCTTTGATATGGATGAATGTCAAGACCCCAGTAGTTGTATTGATGGCCAGTGTGTTAATACAGAGGGCTCTTACAACTGCTTCTGTACTCACCCCATGGTCCTGGATGCGTCAGAAAAAAGATGTATACGACCGGCTGAGTCAAACGAACAAATAGAAGAAACTGATGTCTACCAAGATTTGTGCTGGGAACATCTGAGTGATGAATACGTGTGTAGCCGGCCTCTTGTGGGCAAGCAGACAACGTACACTGAGTGCTGCTGTCTGTATGGAGAGGCCTGGGGCATGCAGTGTGCCCTCTGCCCCCTGAAGGATTCAGATGACTATGCTCAGCTGTGTAACATCCCCGTGACGGGACGCCGGCAGCCATATGGACGGGACGCCTTGGTTGACTTCAGTGAACAGTATACTCCAGAAGCCGATCCCTACTTCATCCAAGACCGTTTTCTAAATAGCTTTGAGGAGTTACAGGCTGAGGAATGCGGCATCCTCAATGGATGTGAAAATGGTCGCTGTGTGAGGGTCCAGGAAGGTTACACCTGCGATTGCTTTGATGGGTATCACTTGGATACGGCCAAGATGACCTGTGTCGATGTAAATGAATGCGATGAGTTGAACAACCGGATGTCTCTCTGCAAGAATGCCAAGTGCATTAACACCGATGGTTCCTACAAGTGTTTGTGTCTGCCAGGCTACGTGCCTTCTGACAAGCCAAACTACTGCACTCCGTTGAATACCGCCTTGAATTTAGAGAAAGACAGTGACCTGGAGTGAAACAGAATCTACATAACCTAAGCCCATATACTCTGCACTGTGTAAAGGAAAAGGGAGAAATGTATTATACTTGAGACATTGCACCTACCCCGGAAGGCTGGAAATACAGAAACAGCATGGAATTGCAAGTCCTCTGAAGACAATGAGAGGATTTAGGATGAGCCCGATAGGTGTGGCAGACCAAATGGACATTTCTCTAAAAAACCAGTATATATAGTCTGTTCATATGTAAAATTCAATGGAAGAGAGGTGGAACAGTGCTGTTATTTTAAACAGAAGGTTGTATTATTATGTTGTTTTGTTTTTTTACTATTGCTTGATTAAATTTGGCATTTAAATAGTGGTGGAAATATTTTATATAATTTTCATTTTTTGGTTGTGCAGTTCCTTGGCTACTGTTTTTCTTTTACTTCAGTTTTTTAAAAATCTCAAATGAAAAAGTCTTCGATACAATATTGTTAAGCTGTATTATAAGTATTGTTACACAGGGTTATGCAATTCCCGGCCTGGAGCATTTTTGAAATTCAAATTGTCTGTCCTGTGGAGCAGGCAGTGATTTTGTTCCAAAACTTTGTATACACATTTGGAGAAAAGTACTTTATATTTTCAGTGTTTTGTCTGATTTTAATGTCCGTTCTTAGCCAAGCTGCTAGCAGGTGTTAATTGGATCCCTTTCCTTCACTGAAATGGAAGAGTTTATAAGCTTACGTTAGTATTGTAATATGTAAAGTAAGCCCAACAAAAATTTTTAAAAATTTGATGATCCCCAATATATCTACCATTGTATGTTAAATAAATCACCATTTTTGTAGAAAAAATTCTACCTGAGAGTAATTGTCAATGAGTACATGTGTATAAGTTGTATCCCACTCTCCCCACTTTTATCTTTTCCAGTGGTCTTCTGTTAATGTAGTGTCTT